ID: 1052378228

View in Genome Browser
Species Human (GRCh38)
Location 9:27741697-27741719
Sequence TGGGCACCCATGTAACAGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052378222_1052378228 3 Left 1052378222 9:27741671-27741693 CCCTGCTTGGTGAGGAAATACGG No data
Right 1052378228 9:27741697-27741719 TGGGCACCCATGTAACAGTCTGG No data
1052378217_1052378228 16 Left 1052378217 9:27741658-27741680 CCAAGCCCGGAGGCCCTGCTTGG No data
Right 1052378228 9:27741697-27741719 TGGGCACCCATGTAACAGTCTGG No data
1052378219_1052378228 11 Left 1052378219 9:27741663-27741685 CCCGGAGGCCCTGCTTGGTGAGG No data
Right 1052378228 9:27741697-27741719 TGGGCACCCATGTAACAGTCTGG No data
1052378216_1052378228 17 Left 1052378216 9:27741657-27741679 CCCAAGCCCGGAGGCCCTGCTTG No data
Right 1052378228 9:27741697-27741719 TGGGCACCCATGTAACAGTCTGG No data
1052378224_1052378228 2 Left 1052378224 9:27741672-27741694 CCTGCTTGGTGAGGAAATACGGG No data
Right 1052378228 9:27741697-27741719 TGGGCACCCATGTAACAGTCTGG No data
1052378221_1052378228 10 Left 1052378221 9:27741664-27741686 CCGGAGGCCCTGCTTGGTGAGGA No data
Right 1052378228 9:27741697-27741719 TGGGCACCCATGTAACAGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052378228 Original CRISPR TGGGCACCCATGTAACAGTC TGG Intergenic
No off target data available for this crispr