ID: 1052378231

View in Genome Browser
Species Human (GRCh38)
Location 9:27741712-27741734
Sequence CAGTCTGGCCACTTTTCTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1087
Summary {0: 23, 1: 57, 2: 122, 3: 223, 4: 662}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052378222_1052378231 18 Left 1052378222 9:27741671-27741693 CCCTGCTTGGTGAGGAAATACGG No data
Right 1052378231 9:27741712-27741734 CAGTCTGGCCACTTTTCTGTAGG 0: 23
1: 57
2: 122
3: 223
4: 662
1052378224_1052378231 17 Left 1052378224 9:27741672-27741694 CCTGCTTGGTGAGGAAATACGGG No data
Right 1052378231 9:27741712-27741734 CAGTCTGGCCACTTTTCTGTAGG 0: 23
1: 57
2: 122
3: 223
4: 662
1052378221_1052378231 25 Left 1052378221 9:27741664-27741686 CCGGAGGCCCTGCTTGGTGAGGA No data
Right 1052378231 9:27741712-27741734 CAGTCTGGCCACTTTTCTGTAGG 0: 23
1: 57
2: 122
3: 223
4: 662
1052378219_1052378231 26 Left 1052378219 9:27741663-27741685 CCCGGAGGCCCTGCTTGGTGAGG No data
Right 1052378231 9:27741712-27741734 CAGTCTGGCCACTTTTCTGTAGG 0: 23
1: 57
2: 122
3: 223
4: 662

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052378231 Original CRISPR CAGTCTGGCCACTTTTCTGT AGG Intergenic
901905503 1:12405896-12405918 CAGTCTGGGGAGTTTTCTGCTGG - Intronic
904887181 1:33748369-33748391 CAGTCTGGTCACTACTCTGAAGG - Intronic
904934046 1:34113937-34113959 CAGTGTTCCCACTTTTCAGTGGG + Intronic
906604255 1:47154218-47154240 CAGTCAGGCCCCTTTTCTGTAGG - Intergenic
906678971 1:47712130-47712152 CAGTCAGGCCAACTTTCTGGAGG + Intergenic
908165431 1:61453002-61453024 CACTCTGCACACTTTTCTTTTGG - Intronic
908317813 1:62950572-62950594 CTTTCTCTCCACTTTTCTGTAGG - Intergenic
908598169 1:65710791-65710813 CAGTCAGGCCTCTCTTCTGCAGG + Intergenic
908865983 1:68548642-68548664 CAGTCTGACCACTGTTCTGCAGG - Intergenic
909047378 1:70727363-70727385 CAGTCTGGTCACTCTTCTGTAGG + Intergenic
909051538 1:70773999-70774021 CACCCTGGCCCCTTTTCTATAGG + Intergenic
909493027 1:76247047-76247069 CAGTCAGGCCTCTCTTCTGCAGG + Intronic
909690335 1:78399463-78399485 TAGTCTGGGCACTTTTCCATAGG + Intronic
909691259 1:78410028-78410050 CAGTCTGGCCACTTTTCTGTAGG - Intronic
909992345 1:82239336-82239358 CAGTCAGGCCTATCTTCTGTGGG + Intergenic
910010497 1:82455371-82455393 CAGTCTGACCACCTCTCTGGAGG - Intergenic
910016719 1:82534351-82534373 TAGTCAGGCCACTTGTCTATAGG + Intergenic
910065126 1:83143034-83143056 CAGACTGGCCTCTTCTCTTTAGG + Intergenic
910619249 1:89235499-89235521 CAGTCTGGACCCTCTTCTGCAGG + Intergenic
910642115 1:89474138-89474160 CAGTCTGGCCACTCTTCCATAGG - Intergenic
910912634 1:92253663-92253685 CAGTCAGGCCCCTCTTCTGCAGG - Intronic
911148972 1:94579366-94579388 CAGTCTGGCCACTCTTTCATAGG + Intergenic
911538553 1:99130329-99130351 TAGTCTGGCCACTTTTCTGTAGG + Intergenic
911568775 1:99497021-99497043 CAGTCTCCCCACTTTGCTTTGGG - Intergenic
911632768 1:100200801-100200823 CAGTCAGGCCCCTCTTCTGCAGG - Intronic
911674965 1:100648021-100648043 CAGTCTGGCCACTCTTCTGTAGG - Intergenic
911835203 1:102610380-102610402 CAGTCTGGCCACTTTTGGGTAGG - Intergenic
912100064 1:106193027-106193049 CAGTCAGGCTACTTTTCCATAGG - Intergenic
912276431 1:108262790-108262812 CAGTCAGGCCTCTCTTCTGCAGG - Intergenic
912280221 1:108304960-108304982 CCGTCTGGCCACTTTTTCGTAGG + Intergenic
912288005 1:108389397-108389419 CCGTCTGGCCACTTTTTCGTAGG - Intronic
912291797 1:108431568-108431590 CAGTCAGGCCTCTCTTCTGCAGG + Intronic
912675957 1:111680774-111680796 CAGTCTGGCCCCTCTTCTGCAGG - Intronic
912893283 1:113557966-113557988 CAGTCTGGCCACTCTTCTGCAGG - Intronic
913410164 1:118542445-118542467 CAGTCTGGCCAGTTTTCTGTAGG - Intergenic
913506961 1:119526124-119526146 CAGTCAGGCCTCTCTTCTGCAGG + Intergenic
914218382 1:145655537-145655559 CAGTCAGGCCCCTCTTCTGTAGG + Intronic
914399511 1:147304720-147304742 CAGTCAGGCCCCTCTTCTGCAGG - Intergenic
914470943 1:147978231-147978253 CAGTCAGGCCCCTCTTCTGTAGG + Intronic
915061261 1:153187950-153187972 CAGTCAGGCCCCTCTTCTGCAGG + Intergenic
915639694 1:157215349-157215371 CAGTCAGGCCCCTCTTCTGTAGG + Intergenic
915663713 1:157425147-157425169 CAGTCAGGCCCCTCTTCTGCAGG - Intergenic
915844898 1:159252700-159252722 CAGTCTGGCCACTTTTCTGCAGG - Intergenic
915995509 1:160558389-160558411 TAGTCAGGCTACTCTTCTGTGGG - Intronic
916568941 1:166008377-166008399 CAGTCTGGCCACTTTTATATAGG + Intergenic
916594669 1:166232847-166232869 CAGTCTGGCCACTTTTCTGTAGG + Intergenic
917007154 1:170427335-170427357 CAGTCAGGCCCCTTTTCTGCAGG - Intergenic
917055559 1:170977953-170977975 CAGACTGGCCCCCTTTCTCTGGG + Intronic
917149515 1:171929361-171929383 CGGTCTGGCCATGTTTTTGTAGG + Intronic
917173326 1:172201862-172201884 CAGTCTGTCTACTTTTCTATAGG + Intronic
917274738 1:173319751-173319773 CAGTCAGGCCCCTCTTCTGCAGG - Intergenic
917305314 1:173618041-173618063 AAGTCAGGCCACTTTTCTGTAGG - Intronic
917585888 1:176426035-176426057 CAGTCTGACCACTTTTCTTCAGG + Intergenic
917719583 1:177774389-177774411 AAGTGTAGCCACGTTTCTGTGGG - Intergenic
917997963 1:180460683-180460705 GAGTCTGGCCACTTTTTTGTAGG - Intronic
918543615 1:185658085-185658107 AAGTCTGGCTCCTTTTCAGTTGG - Intergenic
918614700 1:186531412-186531434 CAGTCAGGCCACTCTTCTGTAGG + Intergenic
918786468 1:188769735-188769757 CAGTCAGGCCCCTCTTCTGCAGG - Intergenic
919231569 1:194780412-194780434 CAGTCAGGCCCCTTTTCTGTAGG - Intergenic
920361568 1:205420545-205420567 AAGTTTGGCCTCTTTTCTGATGG + Exonic
920786923 1:209050857-209050879 CAGTCTGGCCACTTTTCTATAGG - Intergenic
921012987 1:211161428-211161450 CAGTCTGGCCACTTTTCCTTAGG + Intergenic
921484756 1:215703058-215703080 CAGTCAGGGCGCTTTTCTGCAGG + Intronic
921510279 1:216020084-216020106 CAGTCTGTTGACATTTCTGTGGG + Intronic
921880932 1:220253410-220253432 CAGTCTGGCCACTCTACCATAGG - Intronic
922379917 1:225013213-225013235 CAGTCAGGCCCCTCATCTGTAGG + Intronic
922384841 1:225072733-225072755 CAGTCTGGCCACTTTTCTGTAGG + Intronic
922384926 1:225073201-225073223 CAGTCTGACCATGTTTTTGTGGG + Intronic
922385183 1:225074682-225074704 CAGTCTGGCCACCCTTTGGTAGG + Intronic
922406127 1:225315681-225315703 CAGTCAGGCCCCTCTTCTGCAGG + Intronic
923027224 1:230214837-230214859 CAGTCTGGATATATTTCTGTTGG + Intronic
924426026 1:243951157-243951179 CAGAGTGGCCCCTGTTCTGTGGG - Intergenic
924794661 1:247284660-247284682 GCGCCTGGCCACTTGTCTGTGGG + Intergenic
924883779 1:248189837-248189859 CAGTCAGGCCCCTCTTCTGGAGG - Intergenic
1063759868 10:9061636-9061658 CAGTCTTGTCACTTTCCTGAAGG + Intergenic
1066159773 10:32715292-32715314 CAGTCCGGCCCCTCTTCTGCAGG - Intronic
1066251787 10:33640454-33640476 CAGCTTGGCTACTTTTCTATTGG - Intergenic
1067090676 10:43264589-43264611 CACTCTGGCTGCTTTTCTGTTGG - Intronic
1067329339 10:45300777-45300799 CAGTCAGGCCCCTCTTCTGCAGG + Intergenic
1067572161 10:47379599-47379621 CGGTCTGGCCCTTGTTCTGTTGG - Intronic
1067578741 10:47425851-47425873 CAGTCTGTCCACTTTTCCTTAGG - Intergenic
1067923311 10:50481439-50481461 CAGTCAGGCCCTTCTTCTGTAGG - Intronic
1068811057 10:61256739-61256761 CAGTCTGGCCACTCTTCTGAAGG + Intergenic
1069053153 10:63815616-63815638 CAGTCTGTCTGCTTTTTTGTAGG + Intergenic
1069264190 10:66437945-66437967 CAGTCAGGCCCCTCTTCTGCAGG + Intronic
1069340621 10:67403969-67403991 CAGTCTGACCACTTTTCTGTAGG - Intronic
1069360288 10:67633637-67633659 CAGTCAGGTCACTCTTCTGTTGG - Intronic
1069370040 10:67738111-67738133 CAGTCAGGTCACTCTTCTGTTGG - Intergenic
1069427153 10:68298531-68298553 CATTCTTGAAACTTTTCTGTAGG + Intronic
1070054602 10:72923196-72923218 CAGTCTGGCCACTTTTCTGTAGG + Intronic
1070710986 10:78683086-78683108 CAGGCAGGCCACTTCTCTCTGGG - Intergenic
1071001917 10:80840997-80841019 CAGTCAGGCCCCTCTTCTGCAGG + Intergenic
1071340028 10:84637516-84637538 CAGTCAGGCCCCTCTTCTGCAGG - Intergenic
1071788095 10:88925601-88925623 CATTCTTGGCACTTTTTTGTAGG + Intronic
1072361470 10:94663729-94663751 CTGTTAGGCCACTCTTCTGTGGG + Intergenic
1072365243 10:94702980-94703002 CAGTCAGGCCCCTCTTCTGCAGG + Intronic
1072864328 10:99042230-99042252 CAGTCTGGCCTCTTCTCCATAGG - Intronic
1073228224 10:101943051-101943073 CAGTGTGGGAACTTTTCTGCAGG - Intronic
1073400371 10:103252008-103252030 AAGCCTGGCTAATTTTCTGTAGG + Intergenic
1073783659 10:106865419-106865441 CAGTTTGGCCACTTTTTAATAGG - Intronic
1073875832 10:107920473-107920495 CAGTCTGGCCACATTTTTATAGG - Intergenic
1073875876 10:107920745-107920767 CAGTCTGGCCACTTTTCTGTAGG - Intergenic
1074015646 10:109530934-109530956 CAGTCAGGCCCCTCTTCTGCAGG - Intergenic
1074264501 10:111887990-111888012 CAGTCTGCCCCCTACTCTGTGGG - Intergenic
1074407625 10:113192701-113192723 CAGCTTGGCCATTTTTCTGTTGG + Intergenic
1074451724 10:113564662-113564684 TATTCTTCCCACTTTTCTGTAGG - Intronic
1074650738 10:115521991-115522013 CAGTTTAGCCATTGTTCTGTAGG + Intronic
1074782501 10:116812005-116812027 CAGTCTGGCCACTCGTCTTCTGG + Intergenic
1075104440 10:119529035-119529057 CACTTTGGCCACTTGCCTGTAGG + Intronic
1075893857 10:125978056-125978078 AAGTCTGCCCACTTTTCCATAGG + Intronic
1075963463 10:126588589-126588611 TAGTCAGGCCACTCTTCTGTAGG - Intronic
1077391796 11:2303730-2303752 CAGTCCGGCCACTTGTCACTAGG + Intronic
1077391814 11:2303812-2303834 CAGTCCGGCCACTTGTCACTAGG + Intronic
1077755623 11:5024962-5024984 CAGTCTGGCCACTTTTCTGTAGG - Intergenic
1077855174 11:6116486-6116508 CAATCAGGCCCCTCTTCTGTAGG - Intergenic
1078033805 11:7781298-7781320 CAGTCTGGCCACTTTTCTATAGG - Intergenic
1078294799 11:10057175-10057197 CAGTCTGGCCACTTTTCCATAGG - Intronic
1078501768 11:11885995-11886017 CAGTCAGGCCACTCTTCCATAGG - Intronic
1078816114 11:14823779-14823801 CAATCTGGTTACTTTTCTGTAGG - Intronic
1078993079 11:16669464-16669486 CACTCCAGCCACTTTTCTGTAGG - Intronic
1079264988 11:18921994-18922016 CAGTCAGGCCTCTCTTCTGCAGG - Intergenic
1079267163 11:18944141-18944163 CAGTCAGGCCTCTCTTCTGCAGG - Intergenic
1079696226 11:23484914-23484936 CAGTCAGGCCCCTCTTCTGCAGG - Intergenic
1079882667 11:25945415-25945437 CAGTCTGGCCTCCTTTCCTTAGG - Intergenic
1080513670 11:33000685-33000707 CAGTCTGGCCACTCTTCCATAGG + Intergenic
1080965524 11:37210355-37210377 CAGTCAGGCCCCTCTTCTGCAGG + Intergenic
1080977250 11:37357462-37357484 CAGTCAGGCCCCTTTGCTGCAGG - Intergenic
1081094858 11:38920583-38920605 CACTCAGGCCTCTTTTCTGCAGG + Intergenic
1081198908 11:40193347-40193369 CAGTCAGGCCCCTCTTCTGCAGG - Intronic
1081221689 11:40470277-40470299 CAGTCAGGCCCCTCTTCTGCAGG - Intronic
1081348308 11:42017702-42017724 TTCTCTGGGCACTTTTCTGTAGG + Intergenic
1081723505 11:45307441-45307463 CAGTCTTTCCAATTTTATGTTGG + Intergenic
1082184408 11:49162808-49162830 CAGTCTAGCCACTTTTCTGCAGG + Intronic
1082615599 11:55356240-55356262 CAGTCTGGCTGCGTTTTTGTAGG - Intergenic
1082994050 11:59234489-59234511 CAGTCAGGCCCCTTTTCTGCAGG - Intergenic
1083008171 11:59368261-59368283 CACTCTGGCCACTTTTCCATAGG - Intergenic
1083587163 11:63868735-63868757 CAGTCTTGCCTCTTTTTTGATGG + Intronic
1085246457 11:75105531-75105553 CTGTCTGCCCACTCTGCTGTTGG + Intronic
1085335065 11:75687373-75687395 CAGTCAGGCCCCTCTTCTGCAGG + Intergenic
1085880648 11:80463348-80463370 CAGTCTGGCCACTCTTCTGTAGG - Intergenic
1086049984 11:82577932-82577954 TAGTCAGGCCACTCTACTGTAGG - Intergenic
1086303954 11:85459903-85459925 CACTCTGGCCACTTTTCCATGGG + Intronic
1086398533 11:86441865-86441887 CAGCCTGGACACTGTTCTCTGGG + Intronic
1086569164 11:88263070-88263092 CAGTCTGGCCACTTTTCCGAAGG + Intergenic
1086610455 11:88748848-88748870 CAATCAGGCCACTCTACTGTAGG - Intronic
1086681843 11:89682019-89682041 AAGTCTGGCCACGTTTTTGTGGG - Intergenic
1086681941 11:89682560-89682582 CAGTCTAGCCACTTTTCTGCAGG - Intergenic
1086800580 11:91169851-91169873 CAGTCAGGCCCCTCTTCTGCAGG - Intergenic
1086820643 11:91432837-91432859 CAGTCATGTCACTCTTCTGTAGG + Intergenic
1086821940 11:91445875-91445897 CAGCCTGGCCACTTTTTCATGGG - Intergenic
1086821981 11:91446071-91446093 CAGTCTGGCCACTCTTCTGTGGG - Intergenic
1086839445 11:91667124-91667146 AAGTCTGGACACTTTTCCATAGG - Intergenic
1086839533 11:91667650-91667672 GAGTTTGGCCACTTTTCTGTAGG - Intergenic
1086907219 11:92432509-92432531 CAGTCAGGCCCCTCTTCTGCAGG + Intronic
1087071568 11:94086608-94086630 CAGCCTGGTCTCTCTTCTGTAGG + Intronic
1087328952 11:96755614-96755636 CAGTCTGGCTACATTTTGGTAGG + Intergenic
1087399866 11:97651798-97651820 CAGTGTGGCAACTTTTCTATAGG + Intergenic
1087406067 11:97732223-97732245 CAGTCTGGCCACTCTTCCTTAGG - Intergenic
1087427879 11:98013266-98013288 CAGTCAGGCCCCTCTTCTGCAGG - Intergenic
1088078202 11:105878160-105878182 CAGTCAGGACCCTTTTCTGCAGG + Intronic
1088703301 11:112434405-112434427 CAGTCAGGCCCCTCTTCTGTAGG + Intergenic
1088729796 11:112670840-112670862 CAGTCTGGCCACTTTTCCTAGGG - Intergenic
1090307893 11:125705862-125705884 CAGTCAGGCCTCTCTTCTGCAGG - Intergenic
1090505626 11:127310534-127310556 TTGTGAGGCCACTTTTCTGTAGG - Intergenic
1090567224 11:128007388-128007410 CAGTCAGGCCACTCAACTGTAGG - Intergenic
1090724999 11:129517334-129517356 CAGTCAGGCCTCTCTTCTGCAGG + Intergenic
1091089913 11:132762056-132762078 CAGTCAGGCCCCTCTTCTGCAGG + Intronic
1092530238 12:9338087-9338109 CCCTCTGGAGACTTTTCTGTAGG + Intergenic
1092587914 12:9919672-9919694 CAGTCTGGCCACTTTATCATAGG + Intronic
1092638994 12:10482559-10482581 CAGTCTGGCCCCTCTGCTGCAGG - Intergenic
1093086085 12:14868432-14868454 CAGCCTGGCCATTCTTCTGTAGG + Intronic
1093388066 12:18583339-18583361 CAGTCTGGCCACTTTTCTGTAGG - Intronic
1093498117 12:19780216-19780238 CAATCCAGTCACTTTTCTGTGGG + Intergenic
1093498162 12:19780494-19780516 CAATCTGGCCACTTTACCTTGGG + Intergenic
1093498475 12:19783579-19783601 CAGTCTGGCCTCTTTTCTGTGGG + Intergenic
1093528716 12:20135740-20135762 CAGCCTGGCCACTTTTCCCTAGG + Intergenic
1093528803 12:20136268-20136290 CAGTCTGGCCACTTTTTCACAGG + Intergenic
1093690379 12:22102577-22102599 CAGTCTGGCCACTTTTCCACAGG + Intronic
1093892082 12:24534308-24534330 GAGTTTGGTCACTTTTCTGAGGG - Intergenic
1093978851 12:25452959-25452981 CAGTCTGACCTCCTCTCTGTTGG - Intronic
1094060972 12:26315556-26315578 CAGTCAGGCCCCTCTTCTGCAGG + Intergenic
1094242285 12:28242489-28242511 CATGCTGCCCTCTTTTCTGTGGG - Intronic
1094531944 12:31284347-31284369 AAGTGTGTCCATTTTTCTGTTGG + Intronic
1095595413 12:43952033-43952055 CAGTCAGGCCCCTCTTCTGCAGG - Intronic
1095698355 12:45165419-45165441 CAGTCTGGCCACTTTTCCATAGG + Intergenic
1095824334 12:46516063-46516085 CAGTCTGGCCACTTTTCCATAGG + Intergenic
1095831381 12:46590927-46590949 CAGTCAGGCCCCTCTTCTGCAGG + Intergenic
1095835879 12:46638190-46638212 CCGTCTAGCCACTTTTCCATAGG - Intergenic
1095917930 12:47498455-47498477 CAGTCAGGCCTCTCTTCTGCTGG - Intergenic
1095920525 12:47525815-47525837 CAGTCAGGCCCCTCTTCTGCAGG + Intergenic
1095931036 12:47625061-47625083 CAGTCAGGCCCCTCTTCTGCAGG - Intergenic
1096075871 12:48804029-48804051 TATTCTTGCAACTTTTCTGTAGG + Intergenic
1096937892 12:55304002-55304024 CAGTCAGGCCCCTCTTCTGCAGG - Intergenic
1097088438 12:56486999-56487021 CAGTCTGGCTACTTTACTGATGG + Intronic
1097134262 12:56838265-56838287 TAGCATGGCCACTTTACTGTAGG + Intergenic
1097455815 12:59796784-59796806 CAGTCAGGCCCCTCTTCTGTAGG - Intergenic
1097583050 12:61481597-61481619 CAGCCTGGCCACTCTTCAGTAGG - Intergenic
1097643012 12:62205067-62205089 CAGTCAGGCCCCTTTTCCATGGG + Intronic
1097654313 12:62342646-62342668 CAGTCGGGCCCCTCTTCTGCAGG + Intronic
1097890637 12:64773738-64773760 CAGCTTGATCACTTTTCTGTAGG - Intergenic
1098145197 12:67490313-67490335 CAGTCTGGCCACTGTTCCATAGG - Intergenic
1098201726 12:68063720-68063742 CAGTCAGGTCCCTCTTCTGTAGG + Intergenic
1098438680 12:70496464-70496486 CAGTCTGGCCCCTCTGCTGCAGG + Intergenic
1098658718 12:73067304-73067326 CAATCTGGCCACTTTTCCAGAGG + Intergenic
1098733462 12:74066820-74066842 CAGTCAGGCCCCTCTTCTTTAGG - Intergenic
1098764437 12:74468757-74468779 CAGTCAGGCCTCTCTTCTGCAGG + Intergenic
1098830061 12:75350603-75350625 CAGTAAGGCCCCTTTTCTGTAGG - Intronic
1099057239 12:77858655-77858677 TAGTCTGACCACTTTTCTTCAGG + Intronic
1099184625 12:79503910-79503932 CAGTTTGGCCACATTCTTGTAGG - Intergenic
1099184721 12:79504483-79504505 CAGTCTGGCCACTTCTCCGTAGG - Intergenic
1099369575 12:81812566-81812588 CAGTCTGGCCATTCTTCCATAGG - Intergenic
1099498225 12:83378718-83378740 CAGTCTGGCCACATTTCTGTAGG + Intergenic
1099667767 12:85653697-85653719 CAATCTGGACAATTTTCTGTAGG + Intergenic
1099667876 12:85654231-85654253 CATTCTGGCCAAGTTTTTGTAGG + Intergenic
1099943850 12:89222240-89222262 CAATCAGGCCCCTCTTCTGTAGG + Intergenic
1100099936 12:91091431-91091453 CAGTCAGGTCACTCTTCTGTAGG + Intergenic
1100135106 12:91544719-91544741 CAGTCTGGCCACTTTGCCATAGG - Intergenic
1100411232 12:94321892-94321914 CAGTCTGGCCACTTTTCCATAGG + Intronic
1101206493 12:102493629-102493651 CAGTCAGGCCCCTCTTCTGCAGG + Intergenic
1101251370 12:102939324-102939346 CAGTCTGGCCTCTTTTCCATAGG - Intronic
1104546475 12:129717619-129717641 CACACTGGACACATTTCTGTGGG - Intronic
1105672592 13:22636314-22636336 CAGTCAGGCCCCTTTGCTGCAGG + Intergenic
1106358069 13:29003642-29003664 GAGTCTGGCCCCTATTCTGCAGG - Intronic
1106387659 13:29303057-29303079 CAGTCAGGCCATTCTACTGTAGG - Intronic
1106426484 13:29635905-29635927 CAGTCAGGCCCCTTTGCTGCAGG + Intergenic
1106429532 13:29666468-29666490 CAGTCAGGCCCCTGTTCTGCAGG - Intergenic
1106481217 13:30138404-30138426 CATTCTTTCAACTTTTCTGTAGG + Intergenic
1106612196 13:31295060-31295082 CAGTCAGGCCTCTCTACTGTAGG + Intronic
1107188018 13:37546934-37546956 GAGTCTGGCCACTTTTCTGTGGG + Intergenic
1107240840 13:38231782-38231804 CAGTCAGGACACTCTTCAGTAGG - Intergenic
1107722765 13:43266575-43266597 AAGTCTGCCCACTGTTCTCTAGG + Intronic
1108029973 13:46219849-46219871 CAGTCTGGCCCCTCTGCTGCAGG + Intronic
1108383910 13:49880272-49880294 CAGTCAGGCCCCTCTTCTGCAGG - Intergenic
1108479803 13:50856808-50856830 CAGTCAGGCCACTCTTCTGTAGG - Intergenic
1108795378 13:54023938-54023960 GAGTCTGACCAGTTTTCTATAGG - Intergenic
1108800693 13:54091941-54091963 CATTCTGGCCTCTTCTCTATAGG + Intergenic
1108940665 13:55948534-55948556 CAATCTGGCCCCTCTTCTGCAGG - Intergenic
1109146786 13:58790030-58790052 CAGTCAGGCCACTCTTCTATAGG + Intergenic
1109188012 13:59292594-59292616 CAGTCAGTCCCCTTTTCTGCAGG - Intergenic
1109439450 13:62349984-62350006 CAGTCAGGCCACTTTACCATAGG - Intergenic
1109457392 13:62610997-62611019 CAGTCAGGCCCCTCTTCTGCAGG + Intergenic
1109661525 13:65466860-65466882 CAGTCAGGCCTCTCTTCTGCAGG + Intergenic
1109968855 13:69738145-69738167 CAGTCAGGCCCCTTTTCCATAGG - Intronic
1110788574 13:79561489-79561511 CAGTCTGGACACTTTTCCATAGG - Intergenic
1110804334 13:79736774-79736796 CAGCCTGGCCACTTTTCTGGGGG + Intergenic
1110867045 13:80407686-80407708 CAGCCTGGCCACTTTTCTGTAGG + Intergenic
1111090566 13:83440445-83440467 CAAGCTGGCCACGTCTCTGTTGG + Intergenic
1111114314 13:83755319-83755341 CAGTCAGGCCCCTCTTCTGCAGG - Intergenic
1111235156 13:85400138-85400160 CAGTCTGGCCACTTTTCTGTAGG + Intergenic
1111262444 13:85759858-85759880 CAGTCTGTCCATGTATCTGTGGG + Intergenic
1111420171 13:88000660-88000682 CAGCCTGGCCACTTTTCTGGAGG + Intergenic
1111522765 13:89427527-89427549 CAGTCTGGCTACTTTATGGTAGG + Intergenic
1111641726 13:90977959-90977981 CAGTCAGGCCACTCTACTGTAGG - Intergenic
1112165959 13:96919612-96919634 CAGTCAGGCCCCTCTTCTGTAGG - Intergenic
1112231711 13:97594114-97594136 CAGTCAGGCCCCTCTTCTGCAGG - Intergenic
1112546413 13:100376094-100376116 CAGTCAGGCCCCTCTGCTGTAGG + Intronic
1112620052 13:101046193-101046215 CAGTCAGGCCCCTCTTCTGCAGG + Intergenic
1113445575 13:110363817-110363839 CAGCATGGGCACTTTTGTGTGGG + Intronic
1114058991 14:19001850-19001872 GAGTCTGGCCACTTTTCTGAAGG - Intergenic
1114103552 14:19399904-19399926 GAGTCTGGCCACTTTTCTGAAGG + Intergenic
1114278492 14:21169275-21169297 TAGTCTAGCCACTTTTCTGTAGG - Intergenic
1114613899 14:24058366-24058388 CAGTCTGGCCTCTTTTCCAGAGG + Intronic
1114745091 14:25137617-25137639 CAGTCAGGCCCCTCTTCTGCAGG - Intergenic
1115265478 14:31495294-31495316 CAGTCAGGCCCCTCTTCTGCAGG - Intronic
1115867121 14:37760247-37760269 GAGTCAGGCCCCTGTTCTGTAGG + Intronic
1116002410 14:39258828-39258850 CAGTCAGGCCCCTCTTCTGCAGG + Intronic
1116028000 14:39537509-39537531 CAATCTGGCCTCTTTTCCATAGG - Intergenic
1116227624 14:42171797-42171819 CAGTCAGGCCCCTCTTCTGCAGG - Intergenic
1116301512 14:43188951-43188973 CAACCAGGCCACTCTTCTGTAGG - Intergenic
1117299145 14:54407090-54407112 CAGTCAGGCCCCTCTTCTGCAGG + Intronic
1117641151 14:57800267-57800289 CAGTCAGGCCACTCTACTGCAGG - Intronic
1117820561 14:59644806-59644828 CAGTCTGGCCACTTTTCTGTAGG - Intronic
1117820657 14:59645344-59645366 AAGTCTGGCCACTTTTCCATTGG - Intronic
1117829299 14:59733870-59733892 CAGTCTGGCTGCTTTTTGGTAGG - Intronic
1118455295 14:65940481-65940503 GGATCTGACCACTTTTCTGTAGG - Intergenic
1118527552 14:66662426-66662448 CAGTCTGGCCACTTTTCACAGGG - Intronic
1118647200 14:67851531-67851553 CATTCTGGCCACCTCTCTGAAGG + Intronic
1118926902 14:70199522-70199544 CAGTCAGGACCCTCTTCTGTAGG + Intergenic
1120271686 14:82321332-82321354 CAGTCAGGCCACTCTACTGCAGG + Intergenic
1121020746 14:90578667-90578689 CATTCTGGCCCTTTTTCTATGGG - Intronic
1123130770 14:105983636-105983658 CAGTTGGCCCACTTTTATGTTGG + Intergenic
1123581002 15:21714858-21714880 CAGTTGGCCCACTTTTATGTTGG + Intergenic
1123617651 15:22157481-22157503 CAGTTGGCCCACTTTTATGTTGG + Intergenic
1125216554 15:37282528-37282550 CAGTCAGGCCACTCTTCTGCAGG + Intergenic
1126219512 15:46196889-46196911 CAGTCAGACCCCTCTTCTGTAGG + Intergenic
1126225244 15:46262279-46262301 CAGTCTGGCCACTTTTCCATAGG + Intergenic
1127655619 15:61052857-61052879 CAGGCTGGACACTTTTGTGCAGG - Intronic
1128668081 15:69553188-69553210 CAGCCTGGCCACTTTGTTGCAGG + Intergenic
1128852411 15:70973227-70973249 CAGTCAGGCCCCTCTTCTGCAGG + Intronic
1128857401 15:71031241-71031263 CAGTCAGGCCCCTTTTTTGCAGG + Intronic
1129126880 15:73448888-73448910 CAGTCAGGCCCCTCTTCTGCAGG - Intronic
1129566910 15:76633161-76633183 CAGTCAGGTCCCTCTTCTGTAGG + Intronic
1129578041 15:76774710-76774732 TATTCTTGCCACTTTTCTGTAGG + Intronic
1129852784 15:78804019-78804041 CAGTCTGGACACCTTACTGCAGG - Intronic
1129971499 15:79781255-79781277 CAGGCTGGTCAGTTTTCTGTAGG - Intergenic
1130185557 15:81677848-81677870 TTGTCTGGCCACTTTTCTATAGG - Intergenic
1130620082 15:85453356-85453378 CAGTGGGGCCACTTTTCCCTAGG + Intronic
1131590052 15:93739547-93739569 CAATCTGGCCACTTTTCCATAGG + Intergenic
1132063174 15:98709448-98709470 CAGTCAGGCCACTTTAAGGTTGG + Intronic
1132076052 15:98821456-98821478 CACTGTGGCCCCTTTTCTGCTGG + Intronic
1133010190 16:2906163-2906185 GATTCTTGCAACTTTTCTGTAGG - Intergenic
1134676987 16:16097736-16097758 CAGTCTGCCCATCTGTCTGTCGG + Intronic
1136924947 16:34363140-34363162 CACTCTAGCCACTTTACTGGGGG + Intergenic
1136979626 16:35048666-35048688 CACTCTAGCCACTTTACTGGGGG - Intergenic
1137828201 16:51517671-51517693 CAGTCAGGCCTCTCTTCTGCAGG - Intergenic
1138525617 16:57604625-57604647 CACTCTGTGCACTTTGCTGTTGG + Intergenic
1138640475 16:58382128-58382150 CAGCCTTTCAACTTTTCTGTGGG - Intronic
1138997857 16:62475870-62475892 CAGTCTGGTCACTTTTCTATAGG + Intergenic
1144120925 17:12151382-12151404 CAGTCAGGCCACTCTTCCATAGG - Intergenic
1144371873 17:14598652-14598674 CAGTCAGGCCCCTCTTCTGCAGG - Intergenic
1144616792 17:16783541-16783563 CAGTCTGGCCACTCTTCTGCAGG + Intronic
1144869080 17:18357548-18357570 CAGTCTGGACACATTTCTCCAGG + Intronic
1144895902 17:18532132-18532154 CAGTCTGGCCACTCTTCTGCAGG - Intergenic
1145136314 17:20412100-20412122 CAGTCTGGCCACTCTTCTGCAGG + Intergenic
1146825833 17:36022782-36022804 CAGTCAGGCCATTCTTCTGCAGG + Intergenic
1147525367 17:41217027-41217049 CAGTCAGGCCCCTCTTCTGCAGG - Intronic
1150090879 17:62323503-62323525 CAGTCAGGCCCCTCTTCTGCAGG - Intergenic
1150884719 17:69071486-69071508 CAGTCAGGCCCCTCTTCTGCAGG - Intergenic
1153368061 18:4281671-4281693 GAATATAGCCACTTTTCTGTAGG + Intronic
1153424191 18:4944852-4944874 CATTCTGGCTGCTTTTATGTGGG - Intergenic
1153424241 18:4945122-4945144 CAGTCTGGCCAGTTTTACTTGGG - Intergenic
1153743175 18:8150875-8150897 CAGTCTGGCCCCTCTGCTGCAGG + Intronic
1153785347 18:8529197-8529219 CAATCTGGCCACTTTTCCATAGG - Intergenic
1154181681 18:12144312-12144334 CACTCTGGAGACTTTCCTGTAGG + Intergenic
1154182223 18:12147272-12147294 CACTCTGGAGACTTTCCTGTAGG - Intergenic
1154454741 18:14510485-14510507 CAGTCTGGCCACTTTTCTGTGGG + Intronic
1155091278 18:22514456-22514478 CAGTCTGGCCACCTTTCCATAGG + Intergenic
1155184517 18:23375524-23375546 TATTCTTGCAACTTTTCTGTAGG + Intronic
1155247416 18:23923651-23923673 CAGACTGGCCTCCTTTCTGGAGG - Intronic
1155429940 18:25744342-25744364 CAGTCAGGCCCCTCTTCTGCAGG - Intergenic
1155464714 18:26121364-26121386 TAGTCTAGCCCCTTTTCTGTAGG - Intergenic
1155509599 18:26563213-26563235 CAGGCTGCCCACTCTCCTGTGGG - Intronic
1155577130 18:27259941-27259963 CAATCTGGCCACATTTTTGTAGG + Intergenic
1156699954 18:39814433-39814455 CAGTCTGGCCACTTTTCTGTAGG + Intergenic
1157045658 18:44099491-44099513 CAGTCTGGCCTCCTTTCCATAGG + Intergenic
1157695005 18:49715708-49715730 CAGTCAGGCCTCTTTGCTGCAGG + Intergenic
1157707174 18:49816834-49816856 CATTTTTGCAACTTTTCTGTAGG + Intronic
1158143160 18:54279191-54279213 TATTCTGTCAACTTTTCTGTAGG - Intronic
1158932956 18:62338974-62338996 CAGAGTTGCCACTTTGCTGTCGG + Intronic
1159037769 18:63294190-63294212 AAGTCTGGCATCGTTTCTGTTGG - Intronic
1159661127 18:71097372-71097394 CAGTCAGGCCCCTCTTCTGTAGG + Intergenic
1160181971 18:76644588-76644610 CAATCTGGCCACTTTTCTGCAGG + Intergenic
1160546085 18:79657011-79657033 GAGTGTGGCCACTTTTCTCCAGG - Intergenic
1161530413 19:4785596-4785618 CACTCTGACTACTATTCTGTGGG - Intergenic
1164059029 19:21649567-21649589 CAGTCAGGCCCCTCTTCTGTAGG + Intergenic
1164067632 19:21733968-21733990 CAGTCAGGCCCGTCTTCTGTAGG - Intronic
1164152279 19:22565607-22565629 CAGTCAGGCCCCTCTTCTGCAGG + Intergenic
1164599858 19:29553352-29553374 CAGTCAGGCCCCGCTTCTGTAGG - Intronic
1166551957 19:43671607-43671629 CATTCTGTCTCCTTTTCTGTGGG + Intergenic
1166904821 19:46100959-46100981 CAGTCAGGCCCCTCTTCTGTAGG + Intergenic
1166911719 19:46163778-46163800 CAGTCTGTCCTCTTTTCTGTAGG + Intergenic
1168437709 19:56334745-56334767 TAATTTGGCCACTTTTCTATAGG - Intronic
1168530745 19:57127001-57127023 CAGTCAGGCCCCTCTTCTGCAGG + Intronic
925646745 2:6044223-6044245 CGGTCTGGCCACTTTTCCTCGGG - Intergenic
925684756 2:6459162-6459184 CAGTCTGGCAGGTTTTCCGTGGG + Intergenic
926559430 2:14400082-14400104 CAGTTTTGCCTCTTTGCTGTGGG + Intergenic
926668103 2:15547271-15547293 CAATCTGGCTCCTTTTCTGCAGG + Intronic
926987340 2:18639296-18639318 CAGTCTGGCCACTCTTCCATAGG + Intergenic
927076346 2:19581498-19581520 CAGTCAGGCCCCTCTTCTGCAGG - Intergenic
927182898 2:20459501-20459523 CAGTCAGGCCCCTCTGCTGTAGG - Intergenic
928488382 2:31755244-31755266 CAGTCAGTCCCCTCTTCTGTAGG - Intergenic
929062802 2:37941140-37941162 CAGTCAGGCCCCTCTTCTGCAGG + Intronic
929280399 2:40072151-40072173 TAGTCTGACCACTTTTCTGTAGG + Intergenic
929401163 2:41582898-41582920 CAGTCTGGCCAGTTTTCCATAGG - Intergenic
930021705 2:47005622-47005644 TATTCTTGCAACTTTTCTGTAGG + Intronic
930103985 2:47625934-47625956 CATTCTTGCAATTTTTCTGTGGG - Intergenic
930160149 2:48146478-48146500 CAGACTGACCAGTTTTCTGATGG + Intergenic
930229421 2:48827888-48827910 CATTTTGGCCACTTTTCTGTAGG - Intergenic
930304989 2:49666201-49666223 CAGTCTGGCCACTTTTCTGGAGG + Intergenic
930305039 2:49666473-49666495 CAGTTTGGCCACTTTTCTGTAGG + Intergenic
930305175 2:49667283-49667305 CTGTCTGGCCACTTCTCTATAGG + Intergenic
930523064 2:52492326-52492348 CAGTCAGGCCACTCTTCCATAGG + Intergenic
930552365 2:52852111-52852133 CAGTCAGGTCCCTCTTCTGTAGG + Intergenic
930586077 2:53268234-53268256 AATGCTGGCCACTTTTGTGTAGG - Intergenic
930939544 2:56997694-56997716 CAGTCTGGCCACTTTTCACAGGG + Intergenic
931451682 2:62372602-62372624 CTCTTTGCCCACTTTTCTGTTGG + Intergenic
931479037 2:62621634-62621656 CAGTCAGGCCCCTCTTCTGCCGG + Intergenic
931543363 2:63353872-63353894 CAGTTTGGCCACTTTTCTATAGG - Intronic
931560535 2:63555749-63555771 CAGTCAGACCCCTCTTCTGTAGG - Intronic
931659269 2:64543205-64543227 TATTTTGGCCATTTTTCTGTTGG + Intronic
932416191 2:71575141-71575163 CAGGCTGGGCACCTATCTGTAGG + Intronic
933085778 2:78052841-78052863 CTGTCTGGCCAATTTTCCATAGG + Intergenic
933436439 2:82256525-82256547 CAGTCAGGCCACTCTTCTGTAGG + Intergenic
934139015 2:89027326-89027348 GAGCCTGGCCAGGTTTCTGTTGG + Intergenic
934622765 2:95825677-95825699 CAGTCAGGCACCTCTTCTGTAGG + Intergenic
934623244 2:95829198-95829220 CAGTCTGGCCACTTTTCCATAGG + Intergenic
934810522 2:97272894-97272916 CAGTCTGGCCACTTTTCCATAGG - Intergenic
934827170 2:97435045-97435067 CAGTCTGGCCACTTTTCCATAGG + Intergenic
935440869 2:103094281-103094303 CAGTCTGGCCACTTTTTCACAGG + Intergenic
935582720 2:104772155-104772177 CACTCTGTGCACTTTGCTGTTGG + Intergenic
935834642 2:107037204-107037226 CAGTCTGGCCACTTTCCATAGGG - Intergenic
935929863 2:108112937-108112959 CAGTCAGGCCACTCTACTGTAGG + Intergenic
936640172 2:114303545-114303567 CAGTCAGGCCCCTCTTCTGCAGG + Intergenic
936900215 2:117473427-117473449 CAGTCAGGCCCCTCTTCTGCAGG - Intergenic
937389256 2:121469068-121469090 CAGTCTGGTCACTCTTCCGTGGG + Intronic
937397159 2:121547100-121547122 CCGTCTGGCCACTTTTCTGTAGG - Intronic
937526223 2:122772980-122773002 CAGTCAGGCCCCTCTTCTGCAGG - Intergenic
937568968 2:123333640-123333662 TAGTCTGGCAACGTTTTTGTAGG - Intergenic
937569019 2:123333895-123333917 CAGTCTAGCCACCTTTCCGTAGG - Intergenic
938282202 2:130072380-130072402 GAGCCCGGCCACTTTTCTGTAGG + Intergenic
938332829 2:130460952-130460974 GAGCCTGGCCACTTTTCTGTAGG + Exonic
938356979 2:130659719-130659741 GAGCCCGGCCACTTTTCTGTAGG - Intergenic
938433415 2:131266525-131266547 GAGCCCGGCCACTTTTCTGTAGG - Intronic
938477456 2:131629110-131629132 GAGTCCGGCCAATTTTCTGTAGG - Intergenic
938849717 2:135248166-135248188 CAGTCTGGCCAGTTTTCTGTAGG - Intronic
939180485 2:138796832-138796854 CAGTCAGGCCCCTCTTCTGCAGG - Intergenic
939840696 2:147183290-147183312 CAGTCAGGCCCCTCTTCTGTAGG - Intergenic
939942101 2:148362881-148362903 CAGTCAGGCCCCTTTGCTGCAGG - Intronic
939976087 2:148719466-148719488 TAGTCTGGTCACTCTTCTGTAGG + Intronic
940124700 2:150310435-150310457 CAGCCTGGCCACTCTTCCATAGG - Intergenic
940400807 2:153245532-153245554 CAGTCAGGCCCCTTTTCTTCAGG - Intergenic
940581440 2:155584975-155584997 CAGTCTGGCCTCTTCTGTGTAGG - Intergenic
940615086 2:156039245-156039267 CAGTCTGGACAATTTTCTATAGG - Intergenic
940674748 2:156714486-156714508 CAGTCTGGCTACTTTTCTGTAGG + Intergenic
941344347 2:164348689-164348711 AAGCCTGGCCGCTTTTCCGTAGG + Intergenic
941997463 2:171614118-171614140 CAGTCTGCCCATGTTTCAGTGGG - Intergenic
942898865 2:181090112-181090134 CAGTCAGGCCCCTCTTCTGCAGG - Intergenic
942953585 2:181749785-181749807 CAGTCAGGCCCCTTTGCTGCAGG + Intergenic
943112241 2:183621200-183621222 CAGTCAGGCCTCTCTTCTGCAGG + Intergenic
943147592 2:184065391-184065413 CAGTCAGGCCCCTCTTCTGCAGG + Intergenic
943200480 2:184817304-184817326 CAGTCAGGCCATTTTTCTATAGG - Intronic
943548813 2:189312842-189312864 CAGTCTAGCTACTTTTCAGTAGG - Intergenic
943754801 2:191546511-191546533 TAGTCTATCCACTTTTCTGTGGG - Intergenic
944035609 2:195290917-195290939 CAGGCAGGCCCCTCTTCTGTAGG - Intergenic
944292146 2:198019126-198019148 CAGTCAGGCCCCTTTGCTGCAGG - Intronic
944363776 2:198892216-198892238 CAGTCTGGCCACTCTTCTTTAGG - Intergenic
944684986 2:202110162-202110184 CTGTCTGGGGACTCTTCTGTTGG - Intronic
944941424 2:204632521-204632543 TGGTCTGCCCACTCTTCTGTAGG + Intronic
945024238 2:205605503-205605525 CAGTCAGGCCCCTCTTCTGTAGG + Intronic
945164421 2:206927294-206927316 GAGTCAGGCCCCTCTTCTGTAGG - Intergenic
945207332 2:207345343-207345365 CAGTCAGGCCTCTCTTCTGCAGG - Intergenic
945485771 2:210394200-210394222 CATTTTTGCAACTTTTCTGTAGG - Intergenic
946472734 2:219977705-219977727 CATTCTGGCCACTCTGCTGGAGG + Intergenic
946648820 2:221869023-221869045 CAGTCAGGCCACTCTTCTGTAGG - Intergenic
947033604 2:225825452-225825474 CAGTCAGGCACCTATTCTGTAGG - Intergenic
947681307 2:232036768-232036790 CAGTCAGGCCCCTCTTCTGCAGG + Intronic
947751324 2:232534202-232534224 CACTCTGGCCCCTCGTCTGTAGG + Exonic
948016073 2:234691896-234691918 CAGTGTAGCCACATTTCTCTTGG - Intergenic
1168921941 20:1545864-1545886 CAGTCAGGCCACTCTTCTGCAGG + Intronic
1169421228 20:5462635-5462657 CAGTCAGGCCCCTCTTCTGCAGG + Intergenic
1169896690 20:10511699-10511721 CAGTCTGGCCACCTAACTGTGGG - Intronic
1170294341 20:14807335-14807357 CAGTCAGGCCCCTCTTCTGTAGG - Intronic
1170479626 20:16753162-16753184 CATTCTGCCCCCTTTTCTCTGGG - Intronic
1171000959 20:21414730-21414752 CAGTCAGGCCCCTCTTCTGCAGG - Intergenic
1171282091 20:23909753-23909775 CAATCTGGCCACTTTTCTGTAGG + Intergenic
1171397812 20:24849928-24849950 CAGTCAGGCCCCTCTTCTGCAGG + Intergenic
1171441500 20:25166837-25166859 CAGTCAGGCCCCTTTGCTGCAGG - Intergenic
1173006303 20:39142243-39142265 CAGTGTGGCCCCTATTCTGGTGG - Intergenic
1173045003 20:39501449-39501471 CACTTTGGCCACTTTTCAGCAGG - Intergenic
1173294946 20:41748097-41748119 CAGTCTGGCCTCTTCTCTGTAGG + Intergenic
1173647061 20:44639950-44639972 CTCTCTGGCCACAGTTCTGTAGG - Intronic
1174183956 20:48692538-48692560 TGCTCTGGGCACTTTTCTGTAGG + Intronic
1174929234 20:54794678-54794700 TAGTCTGGCTGCTTTTCTGCGGG + Intergenic
1175591829 20:60199828-60199850 CAGTCAGGCCCCTCTTCTGTAGG + Intergenic
1176819423 21:13642823-13642845 CAGTCTGGCCACTTTTCTGTGGG - Intergenic
1176891884 21:14328049-14328071 CAGTCAGGCCCCTCTTCTGCAGG - Intergenic
1177050381 21:16225498-16225520 CAGTCAGGCCCCTCTGCTGTAGG - Intergenic
1177388214 21:20433854-20433876 CAGTCAGGCCTCTCTTCTGTAGG - Intergenic
1177691083 21:24508213-24508235 CAGTATAACCACTTTTCTTTTGG - Intergenic
1178284756 21:31316252-31316274 CATTCTGGCAGCTTCTCTGTGGG - Intronic
1179254697 21:39705053-39705075 CAGTCAGGCCCCTCTTCTGCAGG - Intergenic
1180477475 22:15724466-15724488 GAGTCTGGCCACTTTTCTGAAGG - Intergenic
1183939809 22:41287318-41287340 CATTTTTGCAACTTTTCTGTAGG + Intergenic
1184574732 22:45354101-45354123 CAGTCTGGCTTCCTTTCTGCTGG + Exonic
1184716982 22:46288045-46288067 CAGGCTCCCCACTTTTCTCTGGG - Intronic
949440242 3:4072187-4072209 CAGTCAGGCCACTTAGCTGCAGG - Intronic
950221189 3:11197440-11197462 CCGTATGGCCCCTTTTCTGGGGG - Intronic
950725266 3:14913188-14913210 CAGTCTTTCCACTTTCCTGGGGG - Intronic
950923249 3:16716152-16716174 CAGTCTGGCCACTTTTCTGTAGG + Intergenic
951283381 3:20779849-20779871 CATTCTGGCCACTTTTCTGCAGG - Intergenic
951324362 3:21284983-21285005 CAGTCTGGCCCCTCTGCTGCAGG + Intergenic
951676334 3:25246566-25246588 CAGTCAGGCCCCTTTTCTGCAGG + Intronic
951741794 3:25932380-25932402 CAGTCAGGCCCCTCTTCTGCAGG - Intergenic
951777151 3:26323317-26323339 CAGTCAGGCCACTCTGCTGCAGG + Intergenic
951996485 3:28736006-28736028 CAGTCAGGCCACTCTTCCATAGG + Intergenic
952548625 3:34450349-34450371 CAGTCTGGCCACGTTTTGATAGG + Intergenic
952574665 3:34759764-34759786 CAGTCGGGCCCCTCTTCTGTAGG - Intergenic
952694693 3:36250851-36250873 CAGTCAGGCACCTTTTCTGAGGG - Intergenic
953286752 3:41617514-41617536 CAGTCAGGCCCCTCTTCTGCAGG - Intronic
953816454 3:46162519-46162541 CAGTCTGGCCACTTTTCCATAGG + Intergenic
954454264 3:50588584-50588606 CTGCCTGGCCCCTTTGCTGTGGG - Intergenic
954498629 3:50988772-50988794 CAGTCTGGCCACTTTTCCGTAGG - Intronic
954697428 3:52435240-52435262 CAGAATGGCCATTGTTCTGTAGG + Exonic
954775826 3:53017573-53017595 CAGTCCTGTCACTCTTCTGTTGG - Intronic
955011933 3:55025979-55026001 CAGTTTGGACACTTTTCTGTAGG - Intronic
955439850 3:58943466-58943488 CAGTCAGGCCTCTCTGCTGTAGG - Intronic
955681289 3:61504926-61504948 TAGTCTGGCCGCTTTTCTGTAGG + Intergenic
955864820 3:63371667-63371689 GAGTCTGGCCACTTCTCTGTGGG - Intronic
956157809 3:66317347-66317369 CAGTCAGGCCCCTCTTCTGTAGG + Intronic
956386397 3:68724599-68724621 CAGTCAAGTCACTCTTCTGTAGG + Intergenic
956659764 3:71585277-71585299 GAGTCTGGCCACTTCTGTGGTGG - Intergenic
957747578 3:84365510-84365532 CAGTCAGGCCCCTCTTCTGCAGG + Intergenic
957930843 3:86876408-86876430 CAGTCAGGCCCCTCTTCTGCAGG + Intergenic
958076807 3:88690837-88690859 CAGTCAGGCCACTCTTCTGTAGG - Intergenic
958148441 3:89657933-89657955 CAGTCTGGCCACTTTTCACTAGG + Intergenic
958483737 3:94676939-94676961 CAGTAAGGCCCCTTTTCTGTAGG - Intergenic
958520814 3:95183997-95184019 CAGTCAGGCCCCTCTTCTGCAGG + Intergenic
958590723 3:96154966-96154988 CAGTCTGGCCACTTGTGTGTAGG - Intergenic
958594369 3:96202129-96202151 CAGTCTGGCCTCTTCTCTATAGG - Intergenic
958640618 3:96800499-96800521 TAGTCTGGCCTTTTTTTTGTAGG + Intergenic
958702934 3:97616223-97616245 TGGTCCGGCCACTTTTCTATAGG - Intronic
958759498 3:98291169-98291191 CAGTCTGGCCATTCTTCTGTAGG + Intergenic
958890705 3:99779552-99779574 CAGAGTGGCCAGTTTTCTGGGGG + Intronic
959262948 3:104103771-104103793 CAGTCTGACCAGTTTTCCATGGG + Intergenic
959263969 3:104114368-104114390 CATTCTGTCCACTCTTCTGTAGG - Intergenic
959452136 3:106517311-106517333 CAGTCTGGCCACTTCTCTTTAGG - Intergenic
959479462 3:106853781-106853803 CAGTCAGGCCTCTCTTCTGCAGG - Intergenic
959506763 3:107164683-107164705 CAGTTTGGCCACTCTTCTGTAGG - Intergenic
959520407 3:107317609-107317631 CAGTCTGGCCACTTTTCCGTAGG + Intergenic
959898120 3:111627910-111627932 TAGTCTGGGCACTCTTCTGTAGG - Intronic
959950478 3:112175178-112175200 TAGTCTGGCCACTTTTCCATAGG + Intronic
960226809 3:115178859-115178881 CAGTCAGGCCCCTCTGCTGTAGG + Intergenic
960277122 3:115741667-115741689 CAGTCTGGCCCCTCTTCTGTAGG + Intergenic
960342128 3:116486760-116486782 CAGTCTGACTGCTTTTATGTAGG - Intronic
960342176 3:116487029-116487051 CAGTCTGGCCATTTTTCTGTAGG - Intronic
960342901 3:116497137-116497159 CAGTCTGGCCACCGTTCCATAGG - Intronic
960502404 3:118454178-118454200 CAGTCTAGCCACTCATCTGTGGG + Intergenic
960685241 3:120288201-120288223 CAGTCTGGCCACTTTTCTACAGG - Intergenic
960841484 3:121963465-121963487 CAGTCTGGTCACATTTTTGTAGG - Intergenic
960841538 3:121963736-121963758 CCATCTGGCCACTTTTTTATAGG - Intergenic
961977629 3:131043006-131043028 CAGTCAGGCCCCTCTTCTGCAGG - Intronic
962326520 3:134438468-134438490 CACTCTGCGCACTTTGCTGTTGG + Intergenic
962874095 3:139522634-139522656 CAGCCTGGGCACTTCTCTGTGGG - Intronic
963052997 3:141158341-141158363 CAGTCTGGCTGCTTTTCTGTAGG - Intergenic
963401630 3:144806240-144806262 CAGTCAGGCCCCTCTTCTGCAGG + Intergenic
963532118 3:146483684-146483706 CAGTCAGGCCCCTCTTCTCTAGG - Intronic
963756102 3:149236119-149236141 CAGTCGGGCCACTTTTCCATAGG - Intergenic
964439665 3:156694136-156694158 CAGTCTGGAAATTCTTCTGTAGG + Exonic
964581795 3:158247626-158247648 CAGTCTAGCCTCTCTTCTGTAGG + Intronic
965113048 3:164451591-164451613 CAGACTGGCTTCTTTTCTTTAGG + Intergenic
965346591 3:167558459-167558481 AAGTCTGGCAACTTCTGTGTAGG - Intronic
965621836 3:170650389-170650411 CAGTCAGGCCCCTCTTCTGCAGG + Intronic
965811205 3:172592967-172592989 CAGTCTGGCCACTTTTCCACAGG + Intergenic
966000564 3:174944028-174944050 CAGTCTGGCCACTTTTCCTTAGG + Intronic
966152187 3:176877238-176877260 CAGTCTGGCCACTTTTCTGTAGG - Intergenic
966269854 3:178091261-178091283 CGGTCTGGCCACTTTTCCACAGG - Intergenic
966291294 3:178362003-178362025 CAGTCAGGCCTCTCTTCTGCAGG - Intergenic
966309529 3:178577262-178577284 CAGTCAGGCCCCTCTTCTGCAGG - Intronic
966340958 3:178924375-178924397 CAGTCTGGGCACTTTTCCATAGG - Intergenic
966454870 3:180103008-180103030 CAGTCAGGCCACTCTTCTGTAGG - Intergenic
966561352 3:181324484-181324506 CAGTCAGGCCCCTCTTCTGCAGG + Intergenic
967397441 3:189023728-189023750 CAGTCTGGCCACTCTTTTCTAGG + Intronic
967503075 3:190222621-190222643 TAGTCTGGCCACTTTTCTGCAGG + Intergenic
967574902 3:191077769-191077791 CAGTCTGGCCACTCTTCCATAGG - Intergenic
968380836 4:94690-94712 CAATCTGGCCACCATTTTGTAGG + Intergenic
968696623 4:2033465-2033487 CAGTCAGGCCCCTCTTCTGCAGG + Intronic
968885936 4:3332144-3332166 CAGTGTGGCCCCTTCACTGTTGG + Intronic
969164709 4:5298030-5298052 CAGTCAGGCCCCTCTTCTGCAGG + Intronic
969952521 4:10853347-10853369 CAGTCTGGCCATTCTTCCATAGG + Intergenic
970165051 4:13227601-13227623 CAGTCAGGCCCCTTTTCCGCAGG - Intergenic
971105980 4:23524647-23524669 CAGTCTGGTCACTTTTCTGTGGG - Intergenic
971107461 4:23542315-23542337 CAGTCTGGCTACTTTTCTATAGG - Intergenic
971605340 4:28651385-28651407 CAGTCTGGCCACTTTCCTGTAGG + Intergenic
971605384 4:28651655-28651677 CAGTCTGGCCACATTTTGATAGG + Intergenic
971703319 4:30008050-30008072 CAGTCTGGCCACTGTTCCTGTGG + Intergenic
971746342 4:30586483-30586505 CAGTCCGGCCCCTCTTCTGCAGG + Intergenic
972060970 4:34873082-34873104 CAGTCAGGCCCCTCTTCTGCAGG - Intergenic
972179737 4:36448921-36448943 CAGTTTAGCCACTTTTATGTAGG - Intergenic
972209456 4:36819880-36819902 CATTCTGGCTATTTGTCTGTGGG + Intergenic
972219423 4:36936511-36936533 CAGTCAGGCCCCTCTGCTGTAGG - Intergenic
972773799 4:42223022-42223044 CACTCTTGCAACTTTTCAGTAGG - Intergenic
973114713 4:46441069-46441091 CAATCTGGCCTATTTTATGTAGG - Intronic
973574515 4:52273534-52273556 CAGTCTGGCCAATTTTGCATAGG - Intergenic
973605050 4:52578458-52578480 TATTCTTGCAACTTTTCTGTAGG + Intergenic
974109725 4:57511861-57511883 CAGCCTGCCCACTTTCCTGTAGG + Intergenic
974199754 4:58622956-58622978 CACTCTGGTCACATTTTTGTAGG - Intergenic
974199851 4:58623491-58623513 CACTCTGGCCACTTTTCCATAGG - Intergenic
974222081 4:58987955-58987977 CAGTCTGTGCATTTTTCTGTAGG - Intergenic
974985962 4:69026432-69026454 CACTCTGATCATTTTTCTGTAGG + Intronic
975022094 4:69502566-69502588 CAGTCTGGTCACTTTTCTGTAGG - Intronic
975106203 4:70571690-70571712 CAGCCTGGCCACTTTTCCATAGG + Intergenic
975403957 4:73968368-73968390 GAGTCTGGCCATTTTTCTGTGGG - Intergenic
975479427 4:74860707-74860729 CAGTCAGGCCCCTCTTCTGTAGG - Intergenic
976199319 4:82562765-82562787 CAGTCTGCCCTCTATTCTTTTGG + Intergenic
976358228 4:84145972-84145994 CAGTCTTGGCACTTCTCTGTTGG - Intergenic
976611640 4:87036556-87036578 CTGTCATGCTACTTTTCTGTTGG + Intronic
976852784 4:89567832-89567854 CAGTCAGGCCACTCTTCTGCAGG + Intergenic
976954686 4:90880706-90880728 ACATCTGGCCACTTTTCTGTAGG + Intronic
977002297 4:91519196-91519218 CAGTCCTGCCACTTTTCCATAGG + Intronic
977006294 4:91572156-91572178 TAATCTGGCCACTTTTTTGTAGG + Intronic
977039908 4:92002581-92002603 CAGTCAGGCCCCTCTTCCGTGGG - Intergenic
977060667 4:92254281-92254303 CAGTCAGGCTACTCTTTTGTAGG + Intergenic
977086054 4:92600622-92600644 AAGTCAGGCCCCTCTTCTGTAGG + Intronic
977394131 4:96450678-96450700 CAGTCTGGCCACATTTTCATAGG + Intergenic
977425646 4:96863758-96863780 CAGCCAGGCCTCTCTTCTGTAGG - Intergenic
977508909 4:97937623-97937645 TAGTCAGGTCACTCTTCTGTAGG + Intronic
977649561 4:99454194-99454216 CAGTCTGGCCACTTTTCTGTAGG + Intergenic
977735396 4:100408885-100408907 CAGTCTTGCCTCTTTTCCATAGG + Intronic
977819822 4:101458574-101458596 CAGTCAGACCACGTTTCTGTAGG - Intronic
977971367 4:103217834-103217856 CAGCCTGGCCACTTTTTCATAGG - Intergenic
978090391 4:104707745-104707767 CAGTCAGGCCCCTCTTCTGCAGG - Intergenic
978208212 4:106104903-106104925 TAGTCTGCCCACTTTTCTGTAGG - Intronic
978238374 4:106487558-106487580 CAGTCTGGCCACTTTTCCATAGG + Intergenic
979012429 4:115388142-115388164 CAGTCAGGCCTCTCTTCTGCTGG - Intergenic
979197739 4:117941041-117941063 TAGTCGGGTCTCTTTTCTGTAGG + Intergenic
979576210 4:122294520-122294542 CAGTGGGGCCACTCTTCTGTAGG - Intronic
979998600 4:127463396-127463418 CAGTCAGGCCACTCTGCTGTAGG + Intergenic
980223201 4:129947210-129947232 CAGTCAGGCCCCTCTTCTGCAGG + Intergenic
980331348 4:131415140-131415162 AATTCTGTCCACTTTTCTGTAGG - Intergenic
980333516 4:131440265-131440287 CTGTCTGGCCATTCTTCTGTAGG + Intergenic
980512597 4:133812993-133813015 CAGTCAGACCACTCTTCTGTGGG - Intergenic
980517051 4:133877448-133877470 CAGTCCGGCCACTTTTTCATAGG + Intergenic
980733106 4:136848137-136848159 CAGTCGGGCCCCTCTTCTGCAGG + Intergenic
981133880 4:141189124-141189146 CTGTCAGGCCCCTTTTCTGCAGG + Intronic
981290574 4:143070859-143070881 CAGTCAGGCCTCTCTTCTGCAGG + Intergenic
981321690 4:143399170-143399192 TGGTCTGGCCACTTTACTTTTGG - Intronic
981388908 4:144164371-144164393 CCACCTGGCCACTTTTCTGTAGG + Intergenic
981606642 4:146547043-146547065 CAATCTGTCCACTTTTCGATAGG + Intergenic
981741833 4:148010487-148010509 CATTCTTGCAACCTTTCTGTGGG - Intronic
981885444 4:149667323-149667345 CAGTCAGGCCCCTCTTCTGCAGG - Intergenic
982646182 4:158027267-158027289 CAGTTTGGCCACGTTTTTGTAGG - Intergenic
983167603 4:164496984-164497006 CAGTCAGGCCCCTCTTCTGCAGG + Intergenic
983169494 4:164520283-164520305 CAGTCAGGCCCCTCTTCTGCAGG + Intergenic
983179555 4:164631341-164631363 CAGTCAGGCCCCTCTTCTGCAGG - Intergenic
983331280 4:166332965-166332987 CAGTCAGGCCCCTCTTCTGCAGG + Intergenic
983596215 4:169471370-169471392 CAGTCAGGCCCCTCTTCTGCAGG + Intronic
983628405 4:169826146-169826168 CAGTGTGGCCACTTTTCCTAAGG + Intergenic
983753563 4:171305278-171305300 AAGTCTGGCCACTTTTCTTTAGG - Intergenic
983831185 4:172329898-172329920 CAGTCTGGCCACTTTTCCACAGG + Intronic
983899052 4:173113534-173113556 CAGTCTGGCCACTTTACTGTAGG - Intergenic
984008971 4:174347856-174347878 TAGTCAGGCCCCTCTTCTGTAGG + Intergenic
984525943 4:180859981-180860003 CAGTCAGGCCCCTCTTCTGCAGG + Intergenic
984854091 4:184177770-184177792 CAGTCAGGCCCCTCTTCTGTAGG - Intronic
985174759 4:187189082-187189104 AAGTCTTGTCACTTTTCTGAAGG + Intergenic
985845851 5:2346441-2346463 CAGTCTGGCTGCTTTTTTGTAGG + Intergenic
985861583 5:2475758-2475780 CCGACTGGCCTCTCTTCTGTAGG + Intergenic
986142341 5:5042793-5042815 CAGACTGGTCACTTTTCTCAAGG - Intergenic
986607423 5:9536052-9536074 GCATCTGGCCACTTTGCTGTGGG - Intronic
986753653 5:10812927-10812949 TAGTCAAGCCACTCTTCTGTAGG - Intergenic
986879692 5:12154394-12154416 CAGTCAGGCCCCTCTTCTGCAGG - Intergenic
987415930 5:17662433-17662455 CACTCTGGCCACTCTTCTGTAGG + Intergenic
987431957 5:17845351-17845373 CCGTCTGGCCAGTTTTCTGTCGG + Intergenic
987530718 5:19115478-19115500 CAGTCTGGCCATTTTTCCATAGG - Intergenic
987634898 5:20526650-20526672 CAGTCAGGCCTCTTTTCTGCAGG - Intronic
987887562 5:23831291-23831313 CAATCTGGTCAGTTTTCTGTAGG - Intergenic
988719310 5:33859904-33859926 CAGTCAGGCCCCTCTTCTGCAGG - Intronic
988935982 5:36083324-36083346 CGGTCTGGCCACTTTTCCATAGG - Intergenic
989506054 5:42228846-42228868 CAGACTGTCCACTTCTCTTTAGG + Intergenic
989618946 5:43366412-43366434 CAGTCAGGCTCCTCTTCTGTAGG + Intergenic
989693276 5:44170566-44170588 CAGTCTAGCCAGTTTTCTGTAGG - Intergenic
990230836 5:53711904-53711926 CAGTCAGGCCACTTTTCCATAGG + Intergenic
990359943 5:55007908-55007930 CAGTCTGGCCACTTTTCCATTGG - Intronic
990735102 5:58851874-58851896 GAGTCTGGTCAGTTTACTGTTGG + Exonic
990745745 5:58958334-58958356 CAGTCAGGCCCCTCTTCTGCAGG + Intergenic
990897491 5:60715162-60715184 CAGTCAGGCCTCTTTTCTGCAGG + Intergenic
991135336 5:63176117-63176139 CAGTCTGGCCACTTCTCTGTAGG + Intergenic
991135381 5:63176363-63176385 TAGTCTGGTCACTTTTTTGTAGG + Intergenic
991151572 5:63376710-63376732 CAGTCAGGCCTCTCTTCTGCAGG - Intergenic
992252509 5:74889406-74889428 CACTCTGGCCACTTTTCAGAGGG + Intergenic
992383737 5:76264681-76264703 CAGTCAGGCCCCTCTTCTGCAGG + Intronic
993018498 5:82563633-82563655 CAGTCTGGCCACTTTTCTACAGG - Intergenic
993119240 5:83754357-83754379 CAGTCAGGCCCCTCTTCTGCAGG - Intergenic
993226163 5:85168846-85168868 CAGTTTGGCCATTTTTCCATAGG + Intergenic
993243031 5:85415187-85415209 CAGTCTGACCACTTTTTCGTAGG + Intergenic
993280620 5:85920714-85920736 TGGTCTGGCTGCTTTTCTGTAGG - Intergenic
993351298 5:86853399-86853421 CAGTCTGGCCACTTTTCAATAGG + Intergenic
993375837 5:87149009-87149031 TAGTCAGGCCACTGTTCTGTAGG + Intergenic
993420926 5:87700435-87700457 CAGTCAGGCCCCTCTTCTCTAGG + Intergenic
993450816 5:88070354-88070376 CAGTCTGGTCACTTTTCCTTAGG - Intergenic
993792247 5:92222688-92222710 CAGACTGGCCATTATTTTGTGGG + Intergenic
994242785 5:97444275-97444297 CAGTCTGGCCATTCTTCCATAGG + Intergenic
994277502 5:97855955-97855977 CAGTCTGGCCACTTTTCCATAGG - Intergenic
994344623 5:98669495-98669517 CAGTCAGGTCCCTCTTCTGTAGG - Intergenic
994346695 5:98696312-98696334 CAGTCTGGCCACTTTTCAGTAGG + Intergenic
994473440 5:100238593-100238615 CAGTCTGGCCACTTCTCCATAGG + Intergenic
994622378 5:102178825-102178847 CAGTCAGGCCCCTCTGCTGTTGG + Intergenic
994669950 5:102753721-102753743 CAGTCTGGCCACTGCTCACTAGG + Intergenic
994696521 5:103079279-103079301 TAGTCAGGTCCCTTTTCTGTAGG + Intergenic
994897277 5:105721990-105722012 CAGTCTGGCCACTTTTCCATAGG - Intergenic
995003113 5:107158653-107158675 TAGTCTGGTCCCTCTTCTGTAGG - Intergenic
995052327 5:107720130-107720152 CAGTCAGGCCCCTCTTCTGTAGG - Intergenic
995428641 5:112050421-112050443 CCATCTGGCCACTTTTCCGTAGG - Intergenic
995612464 5:113924500-113924522 CAGTCAGGCCACTCTACTGCAGG - Intergenic
995808674 5:116081071-116081093 CAGTCAGGCCCCTCTTCTGCAGG - Intergenic
996280626 5:121725937-121725959 CAGTCAGGCCCCTCTTCTGCAGG + Intergenic
996425749 5:123312439-123312461 CTGTCTGGCCACTTTTCCATAGG + Intergenic
996463119 5:123770291-123770313 CAGTCAGGCCTCTCTTCCGTAGG + Intergenic
996829761 5:127727153-127727175 CAGTCAGGCCCCTCTTCCGTAGG - Intergenic
996901928 5:128552346-128552368 CAGTCTGGCCACTTTTCAGTGGG - Intronic
997065800 5:130556996-130557018 CAGTGTGGCAACTGTACTGTGGG - Intergenic
997217747 5:132128651-132128673 CAGTCAGGCCCCTCTTCTGCAGG + Intergenic
997459039 5:134039885-134039907 CAGTCTGGAAACTTGGCTGTGGG - Intergenic
998826841 5:146110637-146110659 AATTCTTTCCACTTTTCTGTAGG + Intergenic
999028116 5:148259065-148259087 TAGTCTGGCTACCTTTGTGTAGG + Intergenic
999029960 5:148280532-148280554 CAGTCAGGCCCCTCTTCTGCAGG + Intronic
999488615 5:152026252-152026274 CAGTCAGGCCCCTCCTCTGTAGG + Intergenic
999688417 5:154123050-154123072 CAGTCAGGCCCCTCTTCTGCAGG - Intronic
999959054 5:156735038-156735060 CAGTCTGGCCACTTTTCTTAAGG + Intronic
1000031678 5:157407087-157407109 GAGTCTGACCACTTTTCCATAGG - Intronic
1000194660 5:158946431-158946453 CAGTCAGGCCCCTCTTCTGCAGG + Intronic
1000590135 5:163147625-163147647 CAGTCAGGCCTCTCTTCTGCTGG - Intergenic
1000820090 5:165972900-165972922 CAGTCAGGCCCCTCTTCTTTAGG + Intergenic
1001739021 5:174034822-174034844 TAGTCAGGTCCCTTTTCTGTAGG + Intergenic
1002685896 5:181008923-181008945 CAGTCAGACCCCTTTTCTGCAGG - Intergenic
1005379284 6:25217323-25217345 CAGTATGGCCACTTTGCATTTGG - Intergenic
1005743384 6:28813864-28813886 CATTTTTGCAACTTTTCTGTAGG + Intergenic
1005778260 6:29161266-29161288 CAGTCAGGCCCCTCTTCTGCGGG + Intergenic
1005795865 6:29360670-29360692 CAGTCAGGCCCCTCTTCTGCAGG - Intronic
1006040282 6:31246784-31246806 TAGTCTGACCACTTTTCTGTAGG - Intergenic
1006048695 6:31322197-31322219 CAGTCTGGCCACTTTTCTGCAGG - Intronic
1006457722 6:34141632-34141654 CAGTCTGTCCATGTTTCTCTTGG - Intronic
1006807717 6:36799365-36799387 CACCCTGACCACTCTTCTGTGGG + Intronic
1006936850 6:37724519-37724541 GACTCTGGCCACTTTGCTGGTGG - Intergenic
1007195467 6:40056290-40056312 CAGTCTGGCAACTTTTCCATAGG - Intergenic
1007215731 6:40235745-40235767 TAGTCTGACCACTTTTCTGGAGG - Intergenic
1008173207 6:48234519-48234541 CAGTCTTGCCACTTTTCCATAGG - Intergenic
1008176107 6:48270277-48270299 CAGTCAGGCCCCTCTTCTGCAGG + Intergenic
1008211416 6:48729446-48729468 CAGTCTAACCATTTTTCTGTAGG - Intergenic
1008294330 6:49757258-49757280 CAGTCTGGCTACTTTTCCACAGG + Intergenic
1008355091 6:50543399-50543421 CCCTCTGGCCATATTTCTGTTGG + Intergenic
1008973929 6:57402107-57402129 CAGGCTGGCCACTTTTCCATAGG + Intronic
1009162816 6:60303612-60303634 CAGGCTGGACACTTTTCAATAGG + Intergenic
1009289649 6:61867680-61867702 CAGTCTGTCCACTCTTCCATAGG + Intronic
1009325755 6:62346061-62346083 CCGTCTGGTCACTTTTCCATAGG - Intergenic
1009455364 6:63849568-63849590 CAGTCAGGCCCCTCTTCTGCAGG - Intronic
1009596669 6:65745398-65745420 CAGTCTGGCCAATTTTCCATAGG - Intergenic
1009643869 6:66372602-66372624 GAGTCTGGCCACTTGTCTGTAGG + Intergenic
1009740136 6:67733795-67733817 CAGTGAGGCCCCTCTTCTGTGGG + Intergenic
1009888838 6:69656268-69656290 CAGTCTTTCCACTTTTCTGTAGG - Intergenic
1010019045 6:71138918-71138940 GAGTCTGGCCACTTTTTCATAGG - Intergenic
1010147408 6:72686478-72686500 CAGTCTACCCACTTTTCTGTTGG + Intronic
1010295748 6:74194204-74194226 CAGTCTGGCCACTTTTCCATAGG + Intergenic
1010407238 6:75519264-75519286 AAATCTGGCCTCTTCTCTGTAGG - Intergenic
1010495880 6:76533226-76533248 CAGTCTGACCACATTTCTGTGGG + Intergenic
1011137684 6:84117710-84117732 CAGTTTGGCCACTCTCCAGTAGG + Intergenic
1011370632 6:86633533-86633555 CAGTCTGGCCACATTTTCATGGG + Intergenic
1011377538 6:86706358-86706380 CAGTCAGGCCCCTCTTCTGTAGG + Intergenic
1011392319 6:86867677-86867699 CTGTCTTGCCACTTTTCCATAGG - Intergenic
1011507834 6:88067743-88067765 CAATCTGGCCACTTTTCTGTAGG + Intergenic
1011507886 6:88068005-88068027 CAGTCTGGCCACGTTTTGGTAGG + Intergenic
1011507943 6:88068275-88068297 CAGTCTGGCCACATTTTGGTAGG + Intergenic
1012075135 6:94673122-94673144 CAGTCAAGCCCCTCTTCTGTAGG - Intergenic
1012315156 6:97775710-97775732 CAGTCAGGCCCCTCTTCTATAGG - Intergenic
1012572061 6:100742100-100742122 CAGTCAAGCCACTCTTCTGTAGG + Intronic
1012597010 6:101053396-101053418 CAGTCAGGCCCCTCTTCTGCAGG + Intergenic
1012869517 6:104656958-104656980 CAGTCTGGCCACTCTTCTGTAGG - Intergenic
1012870989 6:104671962-104671984 CAGTCAGGCCCCTTTCCTGCAGG - Intergenic
1013453106 6:110304060-110304082 CAGTCAGGCCCCTCTTCTGCAGG - Intronic
1013461630 6:110379475-110379497 TAGTCAGGCCCCTCTTCTGTAGG - Intergenic
1013929830 6:115516986-115517008 CAGTCTGGCCCCTCTTCTGCCGG - Intergenic
1014183261 6:118407896-118407918 CAGTCTGGCCTCCTTTCCGTAGG - Intergenic
1014238459 6:118988490-118988512 CATTATGCCCACTTTGCTGTAGG + Intronic
1014386968 6:120815433-120815455 CAGTCAGGCCCCTCTTCTGCAGG + Intergenic
1014393482 6:120894527-120894549 CAGTCTGGCCACTCTTCCATAGG + Intergenic
1014560522 6:122884374-122884396 CAGTCAGGCCTCTCTTCTGCAGG - Intergenic
1014584700 6:123183333-123183355 CAGTCAGGCCTCTCTTCTGCAGG - Intergenic
1014753793 6:125281099-125281121 CAGTCAGGCCCCTCTTCTGCAGG - Intronic
1014868328 6:126559340-126559362 CAGTCTGGCCCCTCTCCTATAGG - Intergenic
1015211421 6:130702511-130702533 CAGTCGGGCCCCTGTTCTGCAGG - Intergenic
1015358294 6:132305756-132305778 CAGTCAGGTCCCTCTTCTGTAGG - Intronic
1015427461 6:133088365-133088387 CAGCCTGGCCTCTTATCTGGAGG - Intergenic
1015433119 6:133154312-133154334 CAGACAGGCCCCTCTTCTGTGGG + Intergenic
1015494394 6:133865434-133865456 CAGTCTGGCCACTTTTCTGTAGG + Intergenic
1015587474 6:134790139-134790161 CAGTCAGGCCCCTTTTCCATTGG - Intergenic
1015902014 6:138076889-138076911 CAGTCAGGCCTCTCTACTGTAGG - Intergenic
1016295591 6:142570245-142570267 CAGTCTGGCCTTGTTTCAGTGGG + Intergenic
1016569564 6:145497273-145497295 CTGTCTGGCCACTTTTCCGTAGG + Intergenic
1016700520 6:147048866-147048888 CAGTCTGCCCAGTTCTGTGTGGG + Intergenic
1017536022 6:155348949-155348971 CAGTCTGGCCACTTTTGCATAGG + Intergenic
1017994499 6:159520598-159520620 CAGTCTGGCCACTTTTCCACAGG + Intergenic
1017994596 6:159521145-159521167 CAGTCTGACCACTTTTCCATAGG + Intergenic
1018507734 6:164490205-164490227 CAGTCAGGCCCCTCTTCTGCAGG + Intergenic
1018805904 6:167259191-167259213 CAGTCAGGGCCCTCTTCTGTAGG - Intergenic
1019078910 6:169414149-169414171 CTGTTTGGCCTCTTTTCTCTAGG - Intergenic
1020367130 7:7393206-7393228 CAGTCTGGCCCCTCTGCTGCAGG + Intronic
1020557824 7:9691843-9691865 CAGTCAGGCCTCTTTTCTGCAGG - Intergenic
1020599036 7:10248728-10248750 CAGTCAGGCCCCTCTTCTGCAGG - Intergenic
1020702311 7:11498885-11498907 CAGTCTGGCCACTTTTCCATAGG - Intronic
1020716157 7:11676159-11676181 CAGTCAGGCCCCTCTTCTGCAGG - Intronic
1020823744 7:13002207-13002229 CAGTCAGGCCTCTCTTCTGCAGG + Intergenic
1020994201 7:15241825-15241847 CAGGCTGGGCTCTTATCTGTAGG + Intronic
1021175858 7:17449303-17449325 CAGTCTGGCCACTTTTCTGTAGG + Intergenic
1021179444 7:17488791-17488813 CAGTGTTGCCACCTTTCTGGAGG - Intergenic
1021202422 7:17741590-17741612 CAGTCTGGCCACCTCTTAGTGGG - Intergenic
1021355609 7:19650755-19650777 CAGTCTGGTCACTTTTCTTTGGG - Intergenic
1021355658 7:19651022-19651044 CAGTCTGGCCAGTTTTCTGTGGG - Intergenic
1021502200 7:21344529-21344551 CAGTCAGGCCCCTCTTCTGCAGG + Intergenic
1021539740 7:21744005-21744027 GAGTCTGGGCACTTTACTCTTGG + Intronic
1021782205 7:24117571-24117593 CAGTCAGGCCCCTCTTCTGCAGG + Intergenic
1021916930 7:25443572-25443594 CAGTCAGGCCACTCTACTGTTGG + Intergenic
1022076150 7:26973372-26973394 CAGTCTAGCCCCTTTTCTGTAGG + Intronic
1022077087 7:26982478-26982500 CACTCTGTGCACTTTGCTGTTGG - Intronic
1022256744 7:28665817-28665839 CAGTCTGGGCACCATACTGTAGG + Intronic
1022959858 7:35416045-35416067 CAGCCTGGCTTCTTTTCTGTTGG + Intergenic
1023196100 7:37641518-37641540 CAGTCAGACCACTCTTCTGTAGG + Intergenic
1023327250 7:39073705-39073727 CAGTCTGGGCAGCTTTCTCTTGG - Intronic
1023636997 7:42222082-42222104 CAGCCTGGCCACTTCTCTCTGGG - Intronic
1023666529 7:42528152-42528174 TAGTCAAGCCACTCTTCTGTAGG - Intergenic
1023886401 7:44360303-44360325 CAGTCTGGCCACTTTTCCATAGG + Intergenic
1024165247 7:46723802-46723824 AAGTCTGGACACCTTTTTGTAGG - Intronic
1024167528 7:46749733-46749755 CAGTCTCGTCACATTTTTGTTGG - Intronic
1024590083 7:50873252-50873274 CAGTCAGGCCTCTCTTCTGTAGG - Intergenic
1024703258 7:51927747-51927769 CAGTCAGGCCTCTCTTCTGTAGG + Intergenic
1024795221 7:53012248-53012270 CAGTCAGGCCCCTCTTCTGTAGG + Intergenic
1024990449 7:55231311-55231333 CAGTCAGGCCACTTTTCCACAGG + Intronic
1025158812 7:56635354-56635376 CAGTCTAGCCACATTTTTATAGG - Intergenic
1025158890 7:56635912-56635934 CAGTCTGGCCACTTTACTGAAGG - Intergenic
1025637830 7:63339366-63339388 CAGTCAGGCCCCTCTTCTGCAGG + Intergenic
1025644867 7:63408733-63408755 CAGTCAGGCCCCTCTTCTGCAGG - Intergenic
1025727714 7:64082314-64082336 CAGTCTGGCCACTTTTCTGAAGG + Intronic
1025727796 7:64082902-64082924 CAGTCTAGCCACATTTTTGTAGG + Intronic
1026865867 7:73823671-73823693 CAGTCTTGCCATTATTCTGGTGG + Intronic
1027278981 7:76591714-76591736 CAGACTGGCCTCTTCTCTTTAGG - Intergenic
1027576131 7:79933611-79933633 CAGCCTGGCCACACTTCTGCAGG + Intergenic
1027627641 7:80564797-80564819 CAGTCTGGCCACTTTTCCTTAGG + Intronic
1027944146 7:84723490-84723512 TAGTCTGGCCCCTCTTCTGTAGG - Intergenic
1027956795 7:84888317-84888339 CAATCTGGCCACTTTTTTACAGG + Intergenic
1028077631 7:86534960-86534982 CAGTCTGGCTACTTTTCCGCGGG + Intergenic
1028082899 7:86599948-86599970 CAGTCTGGCCACTTTTCCACAGG - Intergenic
1028176978 7:87671461-87671483 CACTCTGGCCAATTTTCCATAGG + Intronic
1028523108 7:91753332-91753354 CAGTCAGGCCCTTCTTCTGTAGG - Intronic
1028945497 7:96575212-96575234 CAGTCAGGCCCCTCTGCTGTAGG + Intronic
1029052155 7:97700492-97700514 CAGCCTGGCCACTTTTCTGTAGG - Intergenic
1029696506 7:102217186-102217208 CAGTCTGGCCAGATTGCTGAAGG - Intronic
1030234329 7:107242407-107242429 CAGTCTGGCCACTTTGCCATAGG - Intronic
1030375133 7:108745476-108745498 CTGTCTGGCCACTTTTCTATGGG + Intergenic
1030413519 7:109212604-109212626 CAGTCAGGCCCCTCTTCTGTAGG + Intergenic
1030809515 7:113956915-113956937 CATTCTGGCCACATTTATGTAGG + Intronic
1030809618 7:113957455-113957477 CAGGCTGGCAACATTTATGTAGG + Intronic
1031395316 7:121266716-121266738 CAGTCTGGCCAGTATTCTCTAGG - Exonic
1032775646 7:135110014-135110036 TAGTCTAGCTTCTTTTCTGTAGG + Intronic
1033532104 7:142274583-142274605 CAGTCTGGCCACTTTTCTGTAGG + Intergenic
1033565145 7:142570712-142570734 TAGTCAGGCCACTTTATTGTAGG - Intergenic
1033628928 7:143138675-143138697 CAGCCTGGCCACTTGCGTGTAGG - Intronic
1034239186 7:149596805-149596827 CAGTCAGGCCCCTCTTCTGCAGG + Intergenic
1034364380 7:150533852-150533874 CAGTCTGGCCAATTTTCCATAGG + Intergenic
1034973297 7:155432598-155432620 CAGATTGTGCACTTTTCTGTAGG - Intergenic
1035611766 8:971266-971288 CCCTCTGTCCACTTTTCAGTTGG - Intergenic
1035998209 8:4573367-4573389 CAGTCAGGCCCCTCTTCTGCAGG + Intronic
1037541539 8:19876587-19876609 CAGGCTGGGCACTTCTCTGGAGG + Intergenic
1038684914 8:29707752-29707774 CAGGATGGCCTCTTTTCTGCTGG + Intergenic
1039102637 8:33957571-33957593 AAGTCTGACCACTTTGCTGCAGG + Intergenic
1039801896 8:40964898-40964920 CAGTCAGGCCCCTCTTCTGCAGG - Intergenic
1039820609 8:41130686-41130708 CAGTCAGGCCACTGTTCTGTAGG - Intergenic
1040087824 8:43364437-43364459 CAGTCTGGCCACTTTTCCGTAGG - Intergenic
1040091912 8:43407850-43407872 CAGTCTGGCCACTGTTTCATAGG + Intergenic
1040372309 8:46788876-46788898 GGGTCTGGCCACTTTTCTGAAGG + Intergenic
1040372345 8:46789145-46789167 CAGTCTAGCCACATTTCTGTAGG + Intergenic
1040380514 8:46867718-46867740 CAGCCTAGCCACATTTTTGTAGG - Intergenic
1040380548 8:46867988-46868010 CAGTCTGGCCACTTTTCTGAAGG - Intergenic
1040400729 8:47046567-47046589 CAGGCTGGCCACTATTTGGTAGG - Intergenic
1040404584 8:47087364-47087386 CTGTCTGGCCACTTTTCCATAGG + Intergenic
1040858770 8:51977461-51977483 CCTTCTGGCCTCTTTTATGTGGG - Intergenic
1041418981 8:57646243-57646265 CAGTCAGGCCCCTCTTCTGCAGG + Intergenic
1041561783 8:59226441-59226463 CACTCTGGCCACTTTTCTGTAGG - Intergenic
1041615409 8:59900161-59900183 CAGTCTGGCCACTCTTCCACAGG - Intergenic
1041623760 8:60001437-60001459 CAGTCTGGCTACTTTTCCACAGG - Intergenic
1041747494 8:61224414-61224436 TAGTCAGGCCTCTCTTCTGTAGG + Intronic
1041972506 8:63760302-63760324 CAGTCTGGCCACTGTCCCATAGG + Intergenic
1042108601 8:65355611-65355633 AAGTCTGGCCACTTTTCCATAGG + Intergenic
1042489630 8:69382083-69382105 CAGTCTGGCCACTCTTCTGTAGG - Intergenic
1042619960 8:70694042-70694064 CAGTCTGGGCACTTTTCTGTAGG + Intronic
1042644251 8:70968678-70968700 CAGTCAGGCCACCATTCTATAGG + Intergenic
1042725697 8:71874054-71874076 CAGTCTGTCCTCCTATCTGTAGG - Intronic
1042773751 8:72406050-72406072 CAGTCAGGCCCCTCTTCTGCAGG - Intergenic
1043092667 8:75924785-75924807 CTGTCAGGCCCCTCTTCTGTAGG - Intergenic
1043174074 8:77001360-77001382 CAGACTAGCCACTTTTCAGGTGG - Intergenic
1043191130 8:77224793-77224815 CAGTCTGATCACTTTTCTGTAGG + Intergenic
1043229904 8:77788491-77788513 AGTTCTGGCCCCTTTTCTGTAGG + Intergenic
1043299181 8:78705580-78705602 CAGTCTGGCCACATTTTTATGGG + Intronic
1043324686 8:79034825-79034847 CACTCTGGCCACTCTTCTGTAGG - Intergenic
1043396599 8:79843234-79843256 CAGTCTAGCCACTTTTCTATAGG - Intergenic
1043495897 8:80799561-80799583 CAGTCAAGCCACTGTCCTGTAGG - Intronic
1043778247 8:84297868-84297890 CACTCTGCCCACTTTTCTAATGG + Intronic
1044038542 8:87336940-87336962 TAGTCAGGCCCCTCTTCTGTAGG + Intronic
1044162432 8:88935992-88936014 AAGTCTGGCCACTTTTCAGTAGG - Intergenic
1044378030 8:91499604-91499626 CAGTCAGGCCCCTCTTCTGTAGG + Intergenic
1044450880 8:92335112-92335134 CAGTCTGACCACTCTTCTAAAGG + Intergenic
1044656352 8:94552938-94552960 CTCTTTGGCCTCTTTTCTGTCGG - Intronic
1044858367 8:96497748-96497770 CAGTCAAGCCACTGTGCTGTTGG + Intronic
1044873437 8:96642202-96642224 CAGTCTGGCTGCTTTTTGGTAGG + Intergenic
1044961113 8:97531063-97531085 CAGTCAGGCCCCTCTTCTGCAGG - Intergenic
1045185066 8:99829844-99829866 CAATCAGGCCCCTCTTCTGTAGG + Intronic
1045199767 8:99968126-99968148 CAGTCAGGCCCCTCTTCTGCAGG - Intronic
1045323986 8:101103175-101103197 CAGTTTGGCCCCTTTCCTTTTGG - Intergenic
1045338705 8:101232828-101232850 GAGTTTGGCCTCTATTCTGTGGG + Intergenic
1045456303 8:102383077-102383099 CTCACTGGCCACTTGTCTGTCGG - Intronic
1045594317 8:103635449-103635471 CACTCTGGCCACTTTTCCATAGG + Intronic
1045594417 8:103635990-103636012 CAGTCTGGCCTCATTTTGGTAGG + Intronic
1045977907 8:108149963-108149985 CAGTCAAGCCCCTCTTCTGTAGG - Intergenic
1046100687 8:109610760-109610782 CCCTCTGGCCCCTTTTCTGCTGG + Intronic
1046416233 8:113917206-113917228 CAGTCAGGCCCCTCTTTTGTAGG + Intergenic
1046599968 8:116304791-116304813 GAGTCAGGCCACTTTGCTGTAGG - Intergenic
1046657596 8:116912610-116912632 CAGTCAGGCCCCTCTTCCGTAGG + Intergenic
1046986962 8:120398398-120398420 CAGTCAGACCACTTTTCCGTAGG - Intronic
1047003873 8:120599575-120599597 CAGACTGGCCATTTCACTGTTGG + Intronic
1047121412 8:121908823-121908845 CAGTCAGGCCCCTTTGCTGCTGG - Intergenic
1047152021 8:122274269-122274291 CAGTCAGGCCCCTCTTCTGTAGG - Intergenic
1050031873 9:1394276-1394298 CAGTCAGGCCCCTCTTCTGCAGG - Intergenic
1050239800 9:3623581-3623603 CAGTCAGGCCCCTCTTCTGCAGG + Intergenic
1050502360 9:6312527-6312549 CACTCTGGCTGCTTATCTGTTGG - Intergenic
1050880266 9:10690707-10690729 CAGTCGTACAACTTTTCTGTTGG + Intergenic
1051352139 9:16206795-16206817 CAGGGTGGTCACTTTTCTGAGGG + Intronic
1051447294 9:17154385-17154407 CAGTCAGGCCCCTCTTCTGCAGG + Intronic
1051695712 9:19766546-19766568 CAGACAGGCCCCTCTTCTGTAGG + Intronic
1051726027 9:20088964-20088986 TAGTCTGACCACTTTTCTTTAGG - Intergenic
1051822078 9:21180568-21180590 CAGTCTGACCACTTTTCCACAGG - Intergenic
1051823304 9:21192630-21192652 CAGTCTGGCCACTTTTCCATAGG - Intergenic
1051825124 9:21211166-21211188 CAGTCTGGCCACTTTTCCATAGG - Intronic
1051827111 9:21233229-21233251 CAATCTGGCCACTTTTCCATAGG - Intronic
1051899743 9:22025558-22025580 CAGTCTGTTCACTTTTCCATAGG + Intronic
1051899845 9:22026107-22026129 CAGTGTGGCCACATTTTTGTCGG + Intronic
1051914018 9:22185910-22185932 CAGTCTGGCCACTTTTCTATAGG - Intergenic
1051983015 9:23046590-23046612 CAGTCAGGCCCCTCTTCTGCAGG - Intergenic
1052096481 9:24390732-24390754 CAGTCAGGCCCCTCTGCTGTAGG + Intergenic
1052143926 9:25024814-25024836 CAGTCAGGCCTCTCTTCTGCAGG + Intergenic
1052378231 9:27741712-27741734 CAGTCTGGCCACTTTTCTGTAGG + Intergenic
1052626448 9:30982011-30982033 AAGTCTGGTCACTTTTCCATAGG - Intergenic
1052702898 9:31959808-31959830 CAGTCTGGCCACGTTTTGGTAGG - Intergenic
1053039297 9:34856513-34856535 CAGTCAGGCCACTCTTCTGTAGG + Intergenic
1054884811 9:70185127-70185149 CAGTCAGGCCCCTCTTCTGCAGG + Intronic
1054985877 9:71261749-71261771 CAATCAGGCCCCTTTTCTGCAGG + Intronic
1055061532 9:72073395-72073417 CAGTCAGGCCCCTCTTCTGCAGG - Intergenic
1055208558 9:73762459-73762481 CAGCCAGGCCACATTTTTGTAGG - Intergenic
1055224997 9:73984885-73984907 CAGTCTGGCCACCTTTCTGTAGG - Intergenic
1055373547 9:75625164-75625186 CAGTCTGACCAGTTTTCCATAGG + Intergenic
1056095754 9:83251269-83251291 CAGTCAGGCCACTCTACTCTAGG - Intronic
1056600601 9:88043857-88043879 CACTCTGGCCACTTCCCTCTTGG + Intergenic
1057180248 9:93025953-93025975 CAGCCTGGCCACCCTCCTGTTGG + Intronic
1058093175 9:100828990-100829012 CAGTCAGGCCCCTTTTCTGCAGG + Intergenic
1058199955 9:102027477-102027499 CAGCCTGGCCACTCTTCTGTAGG + Intergenic
1058461698 9:105189592-105189614 AAGTATGGCAACTTTTCCGTAGG + Intergenic
1059004101 9:110383308-110383330 CAGTCAGGCCCCTCTTTTGTAGG + Intronic
1059040230 9:110806868-110806890 CAGTGTGACCTCTTTTCCGTGGG + Intergenic
1059076409 9:111197786-111197808 CAGTCAGGCCACCCTACTGTAGG - Intergenic
1059509894 9:114835662-114835684 CAGTCAGGCCACTCTTCTGTAGG + Intergenic
1059924415 9:119193980-119194002 CAGTCTGGCCACTCTGCTGTAGG + Intronic
1061038237 9:128125268-128125290 CAGGATGGGCACCTTTCTGTAGG + Exonic
1061120752 9:128640924-128640946 CCGTCTGGCAACTTTTCTGGGGG + Exonic
1062709267 9:137964928-137964950 CAGTCTGGCCTCTCTTCCCTAGG + Intronic
1203527935 Un_GL000213v1:106747-106769 CAGTCTGGCCACTTTTCTGTGGG + Intergenic
1186369913 X:8936638-8936660 CAGTCAGGCCCCTCTTCTGCAGG + Intergenic
1186593351 X:10953868-10953890 CAGTCTGGCCACTCTTCCATAGG - Intergenic
1187605306 X:20875498-20875520 CAGTCAGGCCCCTCTTCTGCAGG - Intergenic
1188299549 X:28490717-28490739 CTGACTGGGCAATTTTCTGTGGG - Intergenic
1188714981 X:33449457-33449479 CAATCTGGCCAGTTTTCCGTAGG - Intergenic
1188860720 X:35252041-35252063 TAGTCAGGCCCCTCTTCTGTAGG - Intergenic
1188869721 X:35359207-35359229 CCATCTCACCACTTTTCTGTAGG + Intergenic
1188869770 X:35359480-35359502 CAGTCTGGCCACATTTTTGTAGG + Intergenic
1188900971 X:35733253-35733275 CAGTTTGGGCACTCTTCTGTAGG + Intergenic
1189017599 X:37300803-37300825 CACTCAGGCCCCTTTTCTGCAGG + Intergenic
1189492098 X:41478041-41478063 CATTCTTGCAACTTTTCTGTAGG - Intergenic
1189861376 X:45275970-45275992 CAGTCTGGCTGCTTTTTGGTAGG + Intergenic
1189940043 X:46112385-46112407 CAGTCAGGCCCCTCTTCTGTAGG + Intergenic
1190441347 X:50477495-50477517 TATTCTTGCAACTTTTCTGTAGG - Intergenic
1190505991 X:51126120-51126142 CAGTCAGGCCCCTTGTCTGCAGG - Intergenic
1190600533 X:52088394-52088416 TAGTCTGGCCACTTTTCTGTAGG + Intergenic
1190600628 X:52088927-52088949 CACTCTGGCCATGTTTTTGTGGG + Intergenic
1190963631 X:55277356-55277378 CAGTCAGGCCCCTCTTCTGCAGG + Intronic
1190971903 X:55357387-55357409 CAGTCAGGCCCCTCTTCTGTAGG - Intergenic
1191019298 X:55842512-55842534 CAGTCTGGCCACTTGTCCACAGG + Intergenic
1191155132 X:57265830-57265852 CAGTATGGCCACTTTTTCATAGG - Intergenic
1191155222 X:57266365-57266387 CAGTCTGGTCACTTTTCCATAGG - Intergenic
1191174052 X:57481487-57481509 CAGTCAGGCCTCTCTTCTGCAGG + Intronic
1191209539 X:57871032-57871054 CAGTCTGGCCACTCTTCTGTGGG + Intergenic
1191225085 X:58034597-58034619 CAGTCAGGCCTCTTTTCTGTAGG + Intergenic
1191657558 X:63614364-63614386 CAGTCAGGCCCCTCTTCTGCAGG - Intergenic
1191738935 X:64416985-64417007 CAGTCTGGCCAATTTTCCATAGG + Intergenic
1191738978 X:64417257-64417279 CAGTCTGGCTACATTTCTGTAGG + Intergenic
1191743803 X:64464389-64464411 CATTCTGGCCATGTTTTTGTAGG + Intergenic
1191922482 X:66271249-66271271 CACTCTGGCCACTTTTCCACAGG - Intergenic
1191950070 X:66580880-66580902 CAGTCTGGCCACTCTTCTGTAGG - Intergenic
1191993887 X:67068938-67068960 TAGTCTGGCCATGTTTTTGTAGG - Intergenic
1192018557 X:67358632-67358654 CAGTCGGGCCCCTCTTCTGAAGG - Intergenic
1192277380 X:69647928-69647950 CAGTCAGGCCACTGTACCGTAGG + Intronic
1192691836 X:73373028-73373050 CAGTCTGGTCACTTTTCTGTGGG + Intergenic
1192691931 X:73373554-73373576 CAGTCTGGCCACTTTTCCGTGGG + Intergenic
1192701680 X:73481572-73481594 CAGTCAGGCCCCTCTTCTGCAGG + Intergenic
1192718528 X:73668581-73668603 CAGTCTGGCCTCTGTTCCATAGG + Intronic
1192760217 X:74088579-74088601 CAGTCTGTCTGTTTTTCTGTGGG - Intergenic
1192799016 X:74448360-74448382 CCATCTGGCCACTTTGCTGTAGG - Intronic
1192832689 X:74767242-74767264 CAGTCTGGCCACTTTTCAATAGG + Intronic
1192884171 X:75319798-75319820 CAGTCAGGTCCCTCTTCTGTAGG + Intergenic
1192891877 X:75399123-75399145 CAGTCTGGCCACTTTTTCATAGG - Intronic
1192923727 X:75734577-75734599 CAGTCTGGCCACATTTTCATAGG + Intergenic
1192950231 X:76009106-76009128 CAGTCTGGCCACATTTCAGTAGG + Intergenic
1193040360 X:76998234-76998256 CAGTCAGGCCCCTATTCTGCTGG + Intergenic
1193043742 X:77031283-77031305 CAGTCAGGCCTCTCTTCTGCAGG + Intergenic
1193164222 X:78263589-78263611 CAGTCAGGCCCCTCTTCCGTAGG + Intergenic
1193190248 X:78562960-78562982 CAGTCAGGCCCCTCTTCTGCAGG + Intergenic
1193217061 X:78875765-78875787 CAGTCAGGCCCTTCTTCTGTAGG - Intergenic
1193258851 X:79380964-79380986 CAGCCAGGCCACTCTTCTGTAGG - Intergenic
1193301425 X:79892690-79892712 AAGCCTGGTGACTTTTCTGTAGG - Intergenic
1193382054 X:80827417-80827439 CAGTCAGGCCCCTCTTCTGCAGG + Intergenic
1193478509 X:81996768-81996790 CAGTCAGGCCGCTCTTCAGTAGG - Intergenic
1193513413 X:82433493-82433515 CAGTCTGGTCTCTTCTCTGTAGG - Intergenic
1193549921 X:82879250-82879272 CAGCCTGGCCACTTCTCCATAGG - Intergenic
1193685539 X:84572373-84572395 CAGTCAGGCCCCTCTTCTGCAGG - Intergenic
1193739702 X:85203047-85203069 CAGTCTGGCCACCTTTCCATAGG + Intergenic
1193773798 X:85619635-85619657 CAGTCTGGCAACTTTTCCATAGG - Intergenic
1193773935 X:85620470-85620492 CAGACTGGCCTCTTTTCCTTAGG - Intergenic
1193805178 X:85985821-85985843 CAGTCTGGCTGCTTTTCTGTAGG - Intronic
1193817932 X:86125998-86126020 CAGTCTGGCCACTTTTGCATAGG + Intergenic
1193818022 X:86126448-86126470 CAGTCTGGTCACTTTTTCATAGG + Intergenic
1193844728 X:86455011-86455033 CAGTCAGACCACTCTTCTGTAGG + Intronic
1193858915 X:86640102-86640124 CAATCTGGCCACTTTTCCTTAGG - Intronic
1193893573 X:87082400-87082422 TAGTGTGGCCACTTTTCTGTAGG - Intergenic
1193985622 X:88237571-88237593 CAGTCTGGCCACTTTTCTGTAGG + Intergenic
1194029012 X:88789094-88789116 CAGTATGGCCACTTTTCTGTAGG + Intergenic
1194055619 X:89127953-89127975 AAGTCTGGCCACTTTTCTGTAGG + Intergenic
1194067763 X:89283809-89283831 AAGTCTGGTCACTTTTCCATTGG + Intergenic
1194151189 X:90326446-90326468 CAGTATGGCCATGTTTTTGTGGG - Intergenic
1194195170 X:90883340-90883362 AAAACTGACCACTTTTCTGTGGG + Intergenic
1194195249 X:90883889-90883911 CAGACTGGCCACTTTTCCATGGG + Intergenic
1194201520 X:90958198-90958220 CAGTCAGGCCACTTTTCTGTGGG - Intergenic
1194213102 X:91092783-91092805 CCATCTGGACACTTTTTTGTAGG + Intergenic
1194247812 X:91537331-91537353 CAGTCTGGACATGTTTTTGTAGG - Intergenic
1194247904 X:91537867-91537889 CAGTCTGGCCAATTTTCTGTAGG - Intergenic
1194403742 X:93468496-93468518 CAGTTTGGCCTCCTATCTGTTGG - Intergenic
1194403783 X:93468765-93468787 CAGTCTGGCCTCTTCTCCATAGG - Intergenic
1194506314 X:94738423-94738445 CAGTCTGGCCACTCTTCCATAGG + Intergenic
1194520135 X:94908880-94908902 CAGTCTGGTCACTTTTCTGCGGG - Intergenic
1194520180 X:94909152-94909174 CAGTCTGGCCATTTTCTTGTGGG - Intergenic
1194539750 X:95156119-95156141 CAATCTGGCTGCTTTTCTGTGGG - Intergenic
1194580705 X:95666733-95666755 TAATCAGGCCACTATTCTGTAGG - Intergenic
1194593983 X:95835870-95835892 CAGTCTGACCACTTTTCCACAGG + Intergenic
1194623129 X:96197187-96197209 CAGTCAGGCCACTCTATTGTAGG - Intergenic
1194632005 X:96296506-96296528 CAGTCTGGCCACTTTTCCATAGG - Intergenic
1194643284 X:96428818-96428840 CTGTCAGGCCCCTCTTCTGTAGG + Intergenic
1194830520 X:98618406-98618428 CAGTCTTGCCACCTTTCCATAGG + Intergenic
1194839027 X:98715666-98715688 CAGTTTGGCCACTTTCTTTTAGG + Intergenic
1194854702 X:98914958-98914980 GAGTCTGGCCAGTTTTCTGTAGG + Intergenic
1194867553 X:99086814-99086836 CAGCCTGGCCACTTTTCCATAGG - Intergenic
1194917398 X:99722720-99722742 CAGTCTGGCCACATTTCTGTAGG - Intergenic
1194930511 X:99881407-99881429 TAGTCAGGCCCCTTTTCCGTTGG - Intergenic
1194948041 X:100091789-100091811 CAGTCTGGCCCCTTTTCCATAGG - Intergenic
1195104698 X:101593087-101593109 CAGTCTGGCCACTTTTCTGTAGG + Intergenic
1195127332 X:101821776-101821798 CAGTCAGGCCCCTCTTCTGCAGG + Intergenic
1195148677 X:102043780-102043802 CAGTCTGGCCACTTTTCCATAGG - Intergenic
1195361198 X:104085180-104085202 CAGTCTAGCCACTTTTCTACAGG + Intergenic
1195435810 X:104842639-104842661 CAGTCAGGCCCCTCTTCTGTAGG + Intronic
1195812769 X:108852093-108852115 CAGTCAAGCCCCTCTTCTGTAGG - Intergenic
1195820769 X:108943648-108943670 CAGTCAGGCCCCTCTTCTGCAGG + Intergenic
1196227964 X:113188779-113188801 CAGTCTGGCCAATTTTACGTAGG + Intergenic
1196234398 X:113261867-113261889 CAGTCTGGCAGCTTTTCTGTGGG + Intergenic
1196601148 X:117603160-117603182 TGGTCTGGACACTTTTCGGTAGG - Intergenic
1196932602 X:120696306-120696328 GAGTCTGGCCACTTTTCTGTAGG - Intergenic
1197098236 X:122621093-122621115 CAGTCTGGCCCCTCTGCTGCAGG + Intergenic
1197114817 X:122819042-122819064 CAGTCAGGCCACTCTTCTCTAGG - Intergenic
1197122234 X:122906355-122906377 CAGTCTGGCCACATTTTTGTAGG - Intergenic
1197365619 X:125562051-125562073 TATTCTGGCCACTTTTCCATGGG - Intergenic
1197606989 X:128596918-128596940 TAGTCTGGTCCCTGTTCTGTAGG + Intergenic
1197941861 X:131798518-131798540 CAGTCAGACCAATTTTCTTTTGG + Intergenic
1198260251 X:134959629-134959651 CACTCTGTGCACTTTGCTGTTGG - Intergenic
1198443465 X:136687736-136687758 CAGCCTGGCAACCTTTCTTTAGG + Intronic
1198490045 X:137130329-137130351 CAGTCAGGCCCCTCTTCTGCAGG - Intergenic
1198519106 X:137434263-137434285 CAGTCAGGCCCCTCTGCTGTAGG - Intergenic
1198648552 X:138836903-138836925 CAGTCTGGCCCCTTTTCCATAGG + Intronic
1198648660 X:138837444-138837466 CAGTCTGACCACATTTTCGTGGG + Intronic
1198687188 X:139238761-139238783 AAGTCAGGCCACTCTACTGTAGG - Intergenic
1198705524 X:139444024-139444046 CAGTCTGGCCACTTTTCTGTAGG - Intergenic
1198758125 X:140001792-140001814 CAGTCAGGCCCCTCTTCTGCAGG - Intergenic
1199033338 X:143026328-143026350 CAGTTTGGCCCTTTTTCTGGTGG + Intronic
1199182905 X:144879189-144879211 CAGTGTGGCCACTTTTCCATAGG - Intergenic
1199245586 X:145600054-145600076 CAGACTGGCCTCTTTTCCTTAGG - Intergenic
1199249006 X:145638054-145638076 CAGTTTGGCTGCTTTTCTGTAGG - Intergenic
1199394010 X:147312654-147312676 CAGTCTGGCCACGTTTCATAGGG - Intergenic
1199739386 X:150718920-150718942 AAGTCAGGCCCCTCTTCTGTTGG - Intronic
1199773218 X:150988182-150988204 CACTCTGTGCACTTTGCTGTTGG + Exonic
1199830802 X:151546965-151546987 CAGTCAGGCCCCTCTTCTGCAGG - Intergenic
1200336362 X:155354647-155354669 CAGTCTGGCCATGTTTCTGTAGG - Intergenic
1200350108 X:155486580-155486602 CAGTCTGGCCATGTTTCTGTAGG + Intergenic
1200365303 X:155656845-155656867 CAGTCAGGCCCCTCTTCTGCAGG + Intronic
1200497559 Y:3903200-3903222 CAGTATGGCCATGTTTTTGTGGG - Intergenic
1200547361 Y:4533653-4533675 CAGTCAGGCCACTTTTCTGTGGG - Intergenic
1200566830 Y:4778860-4778882 CAGTCTGGACATGTTTTTGTAGG - Intergenic
1200566920 Y:4779396-4779418 CAGTCTGGCCAATTTTCTGTAGG - Intergenic
1200721910 Y:6617970-6617992 AAGTCTGGTCACTTTTCCATTGG + Intergenic
1200853410 Y:7910298-7910320 CAGTTTAGCCACATTTTTGTAGG - Intergenic
1200860596 Y:7987872-7987894 CAATCTGGCCACTTTTCTGAAGG - Intergenic
1200899698 Y:8417066-8417088 CAGTATAGCCACATTTTTGTAGG - Intergenic
1200899728 Y:8417329-8417351 CAGTCTGGCCACTTTTCTGAAGG - Intergenic
1200905729 Y:8480220-8480242 CAGTCTGGCCACTTTTCTGAAGG + Intergenic
1201394664 Y:13536077-13536099 CAGTCAGGCCCCTCTGCTGTAGG + Intergenic
1201936052 Y:19411943-19411965 CAGTCTGCCCAATTTTCTGTAGG - Intergenic
1202250356 Y:22864843-22864865 CAGTCTAGCCACATTTTTGTAGG - Intergenic
1202250392 Y:22865111-22865133 CAGTATGGCCACTTTTCTAAAGG - Intergenic
1202256700 Y:22928784-22928806 CAGTATGGCCACTTTTCTGAAGG + Intergenic
1202266282 Y:23022250-23022272 CAATCTAGCCACATTTCTGTAGG + Intergenic
1202403345 Y:24498591-24498613 CAGTCTAGCCACATTTTTGTAGG - Intergenic
1202403381 Y:24498859-24498881 CAGTATGGCCACTTTTCTAAAGG - Intergenic
1202409691 Y:24562537-24562559 CAGTATGGCCACTTTTCTGAAGG + Intergenic
1202419275 Y:24655993-24656015 CAATCTAGCCACATTTCTGTAGG + Intergenic
1202451511 Y:25014091-25014113 CAATCTAGCCACATTTCTGTAGG - Intergenic
1202461092 Y:25107540-25107562 CAGTATGGCCACTTTTCTGAAGG - Intergenic
1202467398 Y:25171222-25171244 CAGTATGGCCACTTTTCTAAAGG + Intergenic
1202467434 Y:25171490-25171512 CAGTCTAGCCACATTTTTGTAGG + Intergenic