ID: 1052378233

View in Genome Browser
Species Human (GRCh38)
Location 9:27741722-27741744
Sequence ACTTTTCTGTAGGACTGCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052378230_1052378233 -5 Left 1052378230 9:27741704-27741726 CCATGTAACAGTCTGGCCACTTT 0: 14
1: 37
2: 50
3: 80
4: 730
Right 1052378233 9:27741722-27741744 ACTTTTCTGTAGGACTGCTGTGG No data
1052378229_1052378233 -4 Left 1052378229 9:27741703-27741725 CCCATGTAACAGTCTGGCCACTT No data
Right 1052378233 9:27741722-27741744 ACTTTTCTGTAGGACTGCTGTGG No data
1052378224_1052378233 27 Left 1052378224 9:27741672-27741694 CCTGCTTGGTGAGGAAATACGGG No data
Right 1052378233 9:27741722-27741744 ACTTTTCTGTAGGACTGCTGTGG No data
1052378222_1052378233 28 Left 1052378222 9:27741671-27741693 CCCTGCTTGGTGAGGAAATACGG No data
Right 1052378233 9:27741722-27741744 ACTTTTCTGTAGGACTGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052378233 Original CRISPR ACTTTTCTGTAGGACTGCTG TGG Intergenic
No off target data available for this crispr