ID: 1052378611

View in Genome Browser
Species Human (GRCh38)
Location 9:27745090-27745112
Sequence TGAAGAGCAGAGAACTTCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052378611_1052378614 7 Left 1052378611 9:27745090-27745112 CCAGTGAAGTTCTCTGCTCTTCA No data
Right 1052378614 9:27745120-27745142 GCAGTTGTGCCCTCTCCAGTGGG No data
1052378611_1052378615 8 Left 1052378611 9:27745090-27745112 CCAGTGAAGTTCTCTGCTCTTCA No data
Right 1052378615 9:27745121-27745143 CAGTTGTGCCCTCTCCAGTGGGG No data
1052378611_1052378619 28 Left 1052378611 9:27745090-27745112 CCAGTGAAGTTCTCTGCTCTTCA No data
Right 1052378619 9:27745141-27745163 GGGTCAAAAATCTCAGCCATTGG No data
1052378611_1052378613 6 Left 1052378611 9:27745090-27745112 CCAGTGAAGTTCTCTGCTCTTCA No data
Right 1052378613 9:27745119-27745141 AGCAGTTGTGCCCTCTCCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052378611 Original CRISPR TGAAGAGCAGAGAACTTCAC TGG (reversed) Intergenic
No off target data available for this crispr