ID: 1052382352

View in Genome Browser
Species Human (GRCh38)
Location 9:27785161-27785183
Sequence CTGGAAACAGAGCTGAAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052382352_1052382361 14 Left 1052382352 9:27785161-27785183 CCTGGCTTCAGCTCTGTTTCCAG No data
Right 1052382361 9:27785198-27785220 CTGTCTTACTGGCATTCCAGGGG No data
1052382352_1052382359 12 Left 1052382352 9:27785161-27785183 CCTGGCTTCAGCTCTGTTTCCAG No data
Right 1052382359 9:27785196-27785218 TTCTGTCTTACTGGCATTCCAGG No data
1052382352_1052382360 13 Left 1052382352 9:27785161-27785183 CCTGGCTTCAGCTCTGTTTCCAG No data
Right 1052382360 9:27785197-27785219 TCTGTCTTACTGGCATTCCAGGG No data
1052382352_1052382362 23 Left 1052382352 9:27785161-27785183 CCTGGCTTCAGCTCTGTTTCCAG No data
Right 1052382362 9:27785207-27785229 TGGCATTCCAGGGGCCAGTCAGG No data
1052382352_1052382358 3 Left 1052382352 9:27785161-27785183 CCTGGCTTCAGCTCTGTTTCCAG No data
Right 1052382358 9:27785187-27785209 AGTGAGCGGTTCTGTCTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052382352 Original CRISPR CTGGAAACAGAGCTGAAGCC AGG (reversed) Intergenic
No off target data available for this crispr