ID: 1052384551

View in Genome Browser
Species Human (GRCh38)
Location 9:27808093-27808115
Sequence AGTTTTTAAGAGCTGGAGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052384548_1052384551 -1 Left 1052384548 9:27808071-27808093 CCATGGTGGGAGATTGTACGTAA No data
Right 1052384551 9:27808093-27808115 AGTTTTTAAGAGCTGGAGTAGGG No data
1052384543_1052384551 26 Left 1052384543 9:27808044-27808066 CCTTAGTAATATCTTTGAGATTG No data
Right 1052384551 9:27808093-27808115 AGTTTTTAAGAGCTGGAGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052384551 Original CRISPR AGTTTTTAAGAGCTGGAGTA GGG Intergenic
No off target data available for this crispr