ID: 1052390493

View in Genome Browser
Species Human (GRCh38)
Location 9:27873339-27873361
Sequence GATTAATAAATAAAAACTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052390493_1052390498 15 Left 1052390493 9:27873339-27873361 CCTTAAGTTTTTATTTATTAATC No data
Right 1052390498 9:27873377-27873399 TCTACCTTCACAAAAATTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052390493 Original CRISPR GATTAATAAATAAAAACTTA AGG (reversed) Intergenic
No off target data available for this crispr