ID: 1052390495

View in Genome Browser
Species Human (GRCh38)
Location 9:27873361-27873383
Sequence AGGTAGAAAATTAGATGCCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052390495_1052390498 -7 Left 1052390495 9:27873361-27873383 CCCCGGCATCTAATTTTCTACCT No data
Right 1052390498 9:27873377-27873399 TCTACCTTCACAAAAATTTCAGG No data
1052390495_1052390500 12 Left 1052390495 9:27873361-27873383 CCCCGGCATCTAATTTTCTACCT No data
Right 1052390500 9:27873396-27873418 CAGGAATCTGCTGTTATCTTTGG No data
1052390495_1052390501 13 Left 1052390495 9:27873361-27873383 CCCCGGCATCTAATTTTCTACCT No data
Right 1052390501 9:27873397-27873419 AGGAATCTGCTGTTATCTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052390495 Original CRISPR AGGTAGAAAATTAGATGCCG GGG (reversed) Intergenic
No off target data available for this crispr