ID: 1052390498

View in Genome Browser
Species Human (GRCh38)
Location 9:27873377-27873399
Sequence TCTACCTTCACAAAAATTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052390496_1052390498 -8 Left 1052390496 9:27873362-27873384 CCCGGCATCTAATTTTCTACCTT No data
Right 1052390498 9:27873377-27873399 TCTACCTTCACAAAAATTTCAGG No data
1052390495_1052390498 -7 Left 1052390495 9:27873361-27873383 CCCCGGCATCTAATTTTCTACCT No data
Right 1052390498 9:27873377-27873399 TCTACCTTCACAAAAATTTCAGG No data
1052390493_1052390498 15 Left 1052390493 9:27873339-27873361 CCTTAAGTTTTTATTTATTAATC No data
Right 1052390498 9:27873377-27873399 TCTACCTTCACAAAAATTTCAGG No data
1052390497_1052390498 -9 Left 1052390497 9:27873363-27873385 CCGGCATCTAATTTTCTACCTTC No data
Right 1052390498 9:27873377-27873399 TCTACCTTCACAAAAATTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052390498 Original CRISPR TCTACCTTCACAAAAATTTC AGG Intergenic
No off target data available for this crispr