ID: 1052395154

View in Genome Browser
Species Human (GRCh38)
Location 9:27929504-27929526
Sequence GGGTGGGGGTGGAGGGAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052395144_1052395154 -7 Left 1052395144 9:27929488-27929510 CCTCTTCCTTTTACCTGGGTGGG No data
Right 1052395154 9:27929504-27929526 GGGTGGGGGTGGAGGGAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052395154 Original CRISPR GGGTGGGGGTGGAGGGAAGG AGG Intergenic
No off target data available for this crispr