ID: 1052395467

View in Genome Browser
Species Human (GRCh38)
Location 9:27933115-27933137
Sequence CTACCAAGGAGCAGCTCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052395467_1052395469 15 Left 1052395467 9:27933115-27933137 CCAGCAGAGCTGCTCCTTGGTAG No data
Right 1052395469 9:27933153-27933175 GACCAAGTGTTTGTGCCCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052395467 Original CRISPR CTACCAAGGAGCAGCTCTGC TGG (reversed) Intergenic
No off target data available for this crispr