ID: 1052395638

View in Genome Browser
Species Human (GRCh38)
Location 9:27934809-27934831
Sequence ATGGCAGAGTGGAAAGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052395631_1052395638 23 Left 1052395631 9:27934763-27934785 CCAAGGTTTTGTTCTACCTAGAA No data
Right 1052395638 9:27934809-27934831 ATGGCAGAGTGGAAAGAGGATGG No data
1052395633_1052395638 7 Left 1052395633 9:27934779-27934801 CCTAGAAAAGTTTTGGAGTTGAG No data
Right 1052395638 9:27934809-27934831 ATGGCAGAGTGGAAAGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052395638 Original CRISPR ATGGCAGAGTGGAAAGAGGA TGG Intergenic
No off target data available for this crispr