ID: 1052399414

View in Genome Browser
Species Human (GRCh38)
Location 9:27981637-27981659
Sequence GGGGAACAACAGCAGTCCTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 146}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052399414_1052399418 24 Left 1052399414 9:27981637-27981659 CCTAAGGACTGCTGTTGTTCCCC 0: 1
1: 0
2: 0
3: 17
4: 146
Right 1052399418 9:27981684-27981706 TTGTCCATCTAGATTAGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052399414 Original CRISPR GGGGAACAACAGCAGTCCTT AGG (reversed) Intronic
901664620 1:10819353-10819375 TGGGCACCACAGGAGTCCTTGGG + Intergenic
904336504 1:29801651-29801673 GGGGAGGAGCAGCAGGCCTTTGG + Intergenic
906069876 1:43008611-43008633 GGGGAGGAACATCTGTCCTTGGG - Intergenic
908575466 1:65455321-65455343 GGTGAAGAACTGCATTCCTTTGG + Intronic
909159121 1:72122610-72122632 GGGATTCAACAGCAGTTCTTAGG + Intronic
913131041 1:115838673-115838695 GGGGAACAACCGCAGGCCTGTGG + Exonic
914967797 1:152276891-152276913 GGGGAACTAGTGCAGTCATTTGG - Intergenic
916915479 1:169401749-169401771 GGGGAAGAGCTGCATTCCTTTGG - Intronic
917510479 1:175665379-175665401 GGAGCACCACAGCAGTCCTGAGG - Intronic
918392598 1:184082189-184082211 GGGGACAGACATCAGTCCTTAGG + Intergenic
918551062 1:185742963-185742985 GGGGAAAAACATCATTTCTTGGG - Intronic
918855915 1:189755890-189755912 GGTGAAGAACTGCATTCCTTTGG - Intergenic
1066584076 10:36913078-36913100 GGTGAAGAACTGCATTCCTTTGG + Intergenic
1067732149 10:48820254-48820276 CCGGAACACCAGCAGTCCTGAGG + Exonic
1070933833 10:80278581-80278603 GGGAACCATCAGCATTCCTTGGG - Intronic
1073247985 10:102105267-102105289 GGGGTGCAATAGCATTCCTTGGG + Intergenic
1075685753 10:124364195-124364217 GGTGAACAATAGCAGTGCCTGGG + Intergenic
1077788652 11:5413389-5413411 GGTGAAGAACTGCATTCCTTTGG - Intronic
1080109512 11:28549650-28549672 GGGGAGAGATAGCAGTCCTTGGG - Intergenic
1080569710 11:33544870-33544892 GGGCACCAGCAGCAGCCCTTTGG + Exonic
1082002660 11:47401806-47401828 GGGTAAGGACAGCTGTCCTTTGG - Intergenic
1082970155 11:59012119-59012141 GGGTGATAACAGCACTCCTTTGG - Intronic
1085054855 11:73397643-73397665 GGGCAACAGGAGCAGTCCTGGGG + Intergenic
1090025431 11:123163536-123163558 GGGGACCAGCAGCAGTACCTGGG + Intronic
1090946913 11:131438828-131438850 GGAGAGGAACTGCAGTCCTTTGG + Intronic
1091293494 11:134455823-134455845 GGGCAAAACTAGCAGTCCTTGGG + Intergenic
1092575763 12:9781445-9781467 GGGGAACTAGTGCAGTCATTAGG + Intergenic
1094112313 12:26874741-26874763 GTGGAACAACAGCTGTTGTTAGG - Intergenic
1097445405 12:59666125-59666147 GGGAAACAACAACAGTTATTGGG + Intronic
1100266303 12:92979367-92979389 GGGGAACTAGTGCAGTCGTTTGG - Intergenic
1104667549 12:130658031-130658053 GGGGAACAACCCAAGCCCTTGGG - Intronic
1104811084 12:131620873-131620895 GGGGGACAACAGATGTCCCTAGG - Intergenic
1105311429 13:19215759-19215781 GGTGAAGAACTGCATTCCTTTGG + Intergenic
1105406260 13:20134919-20134941 AGGGAAAAGCAGCAGGCCTTTGG - Intergenic
1107468393 13:40668509-40668531 GGGAAGCAACAGCTGTACTTTGG - Intergenic
1108540402 13:51439014-51439036 AGGAAACAACAACAGTCTTTTGG - Intronic
1110185808 13:72673690-72673712 GGGGAACAACAGGGGTTGTTTGG - Intergenic
1111029746 13:82580114-82580136 GGGGAACTAGTGCAGTCTTTTGG + Intergenic
1112764827 13:102729822-102729844 TAGGAAGAACAGCAGTCATTGGG - Exonic
1114015635 14:18426225-18426247 AGAGAACAACAGCAGTGCTCTGG + Intergenic
1115092964 14:29600700-29600722 GTGGAAAGACAGCAGTCCCTTGG - Intronic
1117080732 14:52149900-52149922 GGGGAACTAGTGCAGTCATTTGG + Intergenic
1117467219 14:56005669-56005691 GGGGCAGAACAACAGTCCTTGGG - Intergenic
1123721447 15:23065002-23065024 GGGGAACTAGTGCAGTCATTTGG - Intergenic
1123872750 15:24593291-24593313 AGGGAGCAACAGCTGTCCTTTGG + Intergenic
1124001614 15:25765114-25765136 GGGGAGCACCAGCAGCCCTGTGG + Intronic
1125540473 15:40467044-40467066 GGGGAGCCACAGCACTCCTTTGG - Exonic
1127331920 15:57948098-57948120 ATGGAACCACAGCAGTCCTCAGG - Intergenic
1127971396 15:63965352-63965374 GGGGAACACAAGCACTCCTGTGG + Intronic
1130559571 15:84947390-84947412 GGGGGTCAAGGGCAGTCCTTGGG - Intergenic
1131121018 15:89823494-89823516 GGGGAACCACATCCGTGCTTAGG - Intergenic
1132305631 15:100810094-100810116 GGGAAATAACAGAAGTCCCTGGG + Intergenic
1134057149 16:11177737-11177759 GAGGAACCACAGCAGCCCCTTGG + Intronic
1137478173 16:48828879-48828901 GGGGATCAACATCCTTCCTTTGG - Intergenic
1139961234 16:70718684-70718706 GGGGAGCAACAGCACACCTAAGG - Intronic
1141249111 16:82338807-82338829 GGGGATCAACAGCAGACCTGAGG - Intergenic
1148690820 17:49525836-49525858 GGGGATCAATAGCAGCCCTTCGG + Intergenic
1149055741 17:52362704-52362726 GGTGAACAACATTAGTCATTAGG + Intergenic
1149629516 17:58110698-58110720 GGTCAACACCAGGAGTCCTTGGG - Intergenic
1153690373 18:7586367-7586389 GGGAAAGAACATCAGTCCTTAGG + Intronic
1155183092 18:23365148-23365170 GGGGTACCATAGCAGGCCTTGGG + Intronic
1156063534 18:33112715-33112737 GGGGAACAAGATCAGCACTTGGG + Intronic
1158288860 18:55916444-55916466 AGGAAACAAAAGCAGTCATTTGG - Intergenic
1158303591 18:56080009-56080031 GGAGAACAACAGCCTTCCCTTGG - Intergenic
1161262625 19:3346161-3346183 GGGGAACCCCAGACGTCCTTTGG + Intergenic
1162245526 19:9397058-9397080 GTGCAACAAAAGCAGTTCTTCGG + Intergenic
1168643933 19:58047800-58047822 GGGCAACACCCGCAGTGCTTAGG + Intronic
925571417 2:5316493-5316515 GGCCAACTACAGCAGTCCTTCGG - Intergenic
925884697 2:8384558-8384580 GGGAATCAACAGCAGAGCTTTGG + Intergenic
927922421 2:26983352-26983374 GGGGAAGCAGAGCAGTACTTGGG - Intronic
930063614 2:47310939-47310961 TGGGAATAACAGCATTCGTTGGG + Intergenic
931016029 2:57981920-57981942 GGGGAACTAGTGCAGTCATTTGG + Intronic
933147053 2:78866761-78866783 GGGGAAATAAAGCAGTTCTTGGG + Intergenic
936514714 2:113174317-113174339 GGGAAACAACAGAGGTCCGTGGG - Intronic
937702593 2:124881059-124881081 GGGAAACAAGAACAGTCCATTGG + Intronic
939123484 2:138147054-138147076 GGTGAAAAATAGCAGTCTTTGGG - Intergenic
940085273 2:149851412-149851434 GGTGAAGAACTGCATTCCTTTGG - Intergenic
940415589 2:153416088-153416110 GTGGCACAAAAGCAGTCCTCTGG + Intergenic
944539289 2:200741172-200741194 GGGGAGCAGGAGCAGTCCCTTGG - Intergenic
1168765575 20:380067-380089 GGGGAAGCTCAGCAGACCTTAGG + Intronic
1169485748 20:6030385-6030407 GGAGAAAAACAGCAATCCCTGGG + Intronic
1170675045 20:18471251-18471273 GGGGAACAACATGAGTCCTGTGG - Intronic
1173725286 20:45293220-45293242 GGGGCTCAACAGGAATCCTTGGG - Intergenic
1174245642 20:49177821-49177843 GGAGAAATACAGCAGTCATTTGG + Intronic
1174349062 20:49954158-49954180 GGGTAACAGCAGCAGTGCTGAGG + Intergenic
1178043453 21:28667999-28668021 TGGGAAACACAGAAGTCCTTTGG + Intergenic
1183514664 22:38257888-38257910 GGGGAATAGCAGCAGCCATTAGG - Intronic
951160106 3:19408475-19408497 GGGGAGCTAGTGCAGTCCTTTGG - Intronic
951629878 3:24708053-24708075 GGGCAACAACATCAGTCCTGAGG + Intergenic
953128809 3:40117656-40117678 GAAGAGCAACAGCAGCCCTTAGG + Intronic
955305143 3:57822992-57823014 AAGTAACAACAGCAGTCCTGGGG + Intronic
956784567 3:72631722-72631744 CGAGGACAACAGCAGTCCTATGG + Intergenic
958049642 3:88329098-88329120 GGTGACCAACAGTAGCCCTTGGG + Intergenic
958615827 3:96492987-96493009 GGGGAAGTAGTGCAGTCCTTTGG + Intergenic
961069166 3:123905379-123905401 GGGGCAGAAGAGCAGTACTTAGG + Intronic
964594531 3:158409102-158409124 GGGGAACAACAGCACACACTGGG + Intronic
966454027 3:180094449-180094471 GGGTAACATAAGCACTCCTTTGG + Intergenic
967112140 3:186303366-186303388 GGGGAAAAACAGAGTTCCTTTGG - Intronic
972083485 4:35183154-35183176 GGGGAACAAGTGCAGTCGTTTGG - Intergenic
973347583 4:49072891-49072913 GGTGAAGAACCGCATTCCTTTGG - Intergenic
974914500 4:68162784-68162806 GGGGAACTAGTGCAGTCATTTGG - Intergenic
975489305 4:74970996-74971018 GGGGAACAACAGGAGACCTAAGG + Intronic
976069517 4:81225057-81225079 GTGTAATCACAGCAGTCCTTAGG - Intergenic
979178204 4:117691845-117691867 GGGCAACAACAGCTGCCCTGTGG - Intergenic
980685206 4:136219210-136219232 GGGGAATTACTGCAGTCATTTGG + Intergenic
981337431 4:143582622-143582644 GGGGAACTAGTGCAGTCATTTGG - Intronic
983885340 4:172975002-172975024 AGGGAAGAGCTGCAGTCCTTTGG - Intronic
985225246 4:187753171-187753193 GGTCAACAATTGCAGTCCTTAGG - Intergenic
988655385 5:33205957-33205979 GGGTAACACAAGCAGTCCCTTGG + Intergenic
988658977 5:33243520-33243542 GGGGAACAAGAGAACTCATTGGG + Intergenic
989672647 5:43936506-43936528 AGGGAACATCAGCAGTCGTCTGG + Intergenic
990205560 5:53425337-53425359 TGGGATCAACAGCAGCCATTTGG + Intergenic
994573073 5:101538192-101538214 GGGGAACTAGTGCAGTCATTTGG - Intergenic
996647003 5:125828606-125828628 GGGCATCAACAGCTGCCCTTTGG - Intergenic
997605411 5:135172494-135172516 GGAGAAGATCAGCAGCCCTTAGG - Intronic
1001719969 5:173848775-173848797 GGGGAACATCAGGAGGCCATTGG - Intergenic
1003370338 6:5519188-5519210 GGGAAACAACACCCTTCCTTTGG - Intronic
1009608369 6:65904127-65904149 GGGAAACTACTGCAGTCATTTGG - Intergenic
1010178000 6:73051851-73051873 GGGGAACTACTGCAGTTGTTTGG - Intronic
1010901648 6:81434444-81434466 GGTGAGGAACAGCATTCCTTTGG - Intergenic
1011603933 6:89083468-89083490 GGGGAACAACAACAGACACTAGG - Intronic
1011805286 6:91065237-91065259 GGGGAACACCTGCAGTTCTGTGG + Intergenic
1012945356 6:105460183-105460205 GGACAACTACAGCAGTCCTGTGG + Intergenic
1019100584 6:169626192-169626214 GGGGAGCAACTGCAGGCCATAGG + Intronic
1019839237 7:3422746-3422768 GGGGAAAAGCAGGAGTACTTAGG + Intronic
1020485277 7:8713860-8713882 GGTGAACACAAGCACTCCTTTGG + Intronic
1021813040 7:24422507-24422529 CAGGATCAACAGCTGTCCTTGGG - Intergenic
1024341039 7:48260148-48260170 GGGGAACTAGAGCAGTCATGTGG + Intronic
1025090298 7:56057231-56057253 AGTGAACAACATCAGTCATTTGG + Intronic
1025832730 7:65067621-65067643 GGTGAACAACATCAGTCATTTGG + Intergenic
1025902502 7:65757149-65757171 GGTGAACAACATCAGTCATTTGG + Intergenic
1026019553 7:66696924-66696946 GGGGAAGAACAGCTGGCCATGGG + Intronic
1026880835 7:73905663-73905685 GGGGAAGAACAGCTGGCCGTGGG - Intergenic
1030659318 7:112203966-112203988 TGAGAACAACAGCAGTAATTTGG + Intronic
1033000089 7:137493785-137493807 GGGGAACTAGTGCAGTCATTTGG - Exonic
1034087659 7:148334795-148334817 GGGGAACTCCAGCAATCATTGGG + Intronic
1035646073 8:1222116-1222138 GGGGAGCTAGAGCAGTCATTTGG + Intergenic
1036054845 8:5239824-5239846 GGGGAGCCACTGCAGTCCTTTGG - Intergenic
1037109141 8:15144801-15144823 AGGGAAAAGCAGCAGTGCTTAGG + Intronic
1038184097 8:25257182-25257204 AGGGACCAACGGCAGTGCTTAGG - Intronic
1039252919 8:35686461-35686483 CTAGAACAACAGCAGTCCTGGGG + Intronic
1040628190 8:49175952-49175974 AGGGAACATCAGCAGTACTCTGG + Intergenic
1040754271 8:50752387-50752409 TGGGAACTAAAGCAGTCCTTTGG + Intronic
1044588668 8:93892460-93892482 GGAGGACACCACCAGTCCTTTGG - Intronic
1045621054 8:103979188-103979210 GGGGGACAAAAGCAGTATTTAGG + Intronic
1046379746 8:113435832-113435854 TGGGAAAAAGAGCTGTCCTTAGG - Intronic
1046596889 8:116272009-116272031 GGGGAACTAGTGCAGTCATTTGG + Intergenic
1047000776 8:120570381-120570403 GGGGAACAGCAGGAGTCTTTGGG - Intronic
1050297735 9:4222991-4223013 GGGAACAAACAGCACTCCTTAGG + Intronic
1052399414 9:27981637-27981659 GGGGAACAACAGCAGTCCTTAGG - Intronic
1056075385 9:83033376-83033398 GGTGAACATGACCAGTCCTTGGG + Intronic
1057034320 9:91800704-91800726 GGAGGACAACAGCAGTGCGTGGG - Intronic
1060940766 9:127541819-127541841 GGGGTACAACAGCAGACCCCTGG + Intronic
1062233083 9:135493597-135493619 GGGAAACAAACGCAGTCATTTGG + Intergenic
1188012784 X:25075300-25075322 GGGTAACAAAAGCAATTCTTAGG - Intergenic
1193961167 X:87925962-87925984 GGGGAATTACTGCAGTCATTAGG - Intergenic
1194290255 X:92063590-92063612 GGGGAACTAGAGCAGTTATTTGG + Intronic
1194937694 X:99970793-99970815 GGGTAGCACCAGCACTCCTTTGG + Intergenic
1194945983 X:100068080-100068102 TGTGGACAACAGTAGTCCTTGGG - Intergenic
1195541352 X:106067139-106067161 GGAGAACTACTGTAGTCCTTTGG + Intergenic
1195727996 X:107936925-107936947 ATGGAACAGCAGCTGTCCTTGGG + Intergenic
1196554625 X:117071650-117071672 GGAGAACTACTGCAGTCTTTTGG - Intergenic
1199786881 X:151113920-151113942 GGGGAACTAGTGCAGTCATTTGG + Intergenic
1200607770 Y:5288181-5288203 GGGGAACTAGAGCAGTTATTTGG + Intronic