ID: 1052399415

View in Genome Browser
Species Human (GRCh38)
Location 9:27981656-27981678
Sequence ATCTGCTCTCTCAATAAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 151}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052399415_1052399418 5 Left 1052399415 9:27981656-27981678 CCCCTCTTATTGAGAGAGCAGAT 0: 1
1: 0
2: 1
3: 13
4: 151
Right 1052399418 9:27981684-27981706 TTGTCCATCTAGATTAGTGAAGG No data
1052399415_1052399420 24 Left 1052399415 9:27981656-27981678 CCCCTCTTATTGAGAGAGCAGAT 0: 1
1: 0
2: 1
3: 13
4: 151
Right 1052399420 9:27981703-27981725 AAGGTCCAGAAAGAAAAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052399415 Original CRISPR ATCTGCTCTCTCAATAAGAG GGG (reversed) Intronic
901962727 1:12840301-12840323 AAGTGCTCTCTCAATAAAACGGG - Intergenic
901969288 1:12894787-12894809 AAGTGCTCTCTCAATAAAACGGG - Exonic
901989916 1:13104604-13104626 AAGTGCTCTCTCAATAAAACGGG - Intergenic
902015884 1:13306993-13307015 AAGTGCTCTCTCAATAAAACGGG + Intronic
902322954 1:15681830-15681852 TTCTGCTCTCTGAATATGAGAGG + Intergenic
908875078 1:68664086-68664108 ATATCCTCTGCCAATAAGAGGGG - Intergenic
909968162 1:81944215-81944237 GTCTGTTCTCTCAGTAGGAGAGG + Intronic
910043071 1:82877230-82877252 ATGTTCTCTATCAATAAGGGAGG - Intergenic
915520492 1:156439631-156439653 CTGTGCTCTCTCAAGAGGAGAGG + Intergenic
917529019 1:175816265-175816287 GACTGCCCTCCCAATAAGAGAGG + Intergenic
1064890632 10:20168118-20168140 CTTTGCTCCCTCAAAAAGAGAGG + Intronic
1066824771 10:39554916-39554938 ATCTGCTCTATCAAAAAGGAAGG - Intergenic
1070456770 10:76624794-76624816 CTCTGCTCTCCAATTAAGAGTGG - Intergenic
1072983857 10:100122380-100122402 ATCTGCTCTCTCCATCACGGAGG - Intergenic
1073538251 10:104297085-104297107 ATCTGCTTTATCAATAAGAAAGG - Intronic
1075401745 10:122165873-122165895 CTCTGCTCTCTGAATAACTGGGG + Intronic
1076102109 10:127791141-127791163 ATGTGATCTTTCATTAAGAGAGG - Intergenic
1078708494 11:13767888-13767910 ATCTGCTGTCTCACTAATGGTGG - Intergenic
1078730460 11:13969463-13969485 TTCTCCTTTCTCAATAAAAGAGG + Intronic
1080566994 11:33519259-33519281 ATCTACTCTCTCAAAAAAAATGG - Intergenic
1081255268 11:40885300-40885322 ATCTGCTTTCTCTAAAAAAGAGG - Intronic
1081341298 11:41931044-41931066 CTCTGGTCTCTAAATAAGAAAGG - Intergenic
1090765751 11:129874574-129874596 ATCCGCTCTGTGAACAAGAGGGG + Exonic
1090932531 11:131311077-131311099 ATCTACTCTCTCAAAAGGATAGG + Intergenic
1092020910 12:5201591-5201613 ATTTTCTCTCTAATTAAGAGTGG - Intergenic
1093819920 12:23601870-23601892 ATCTTTTCTGACAATAAGAGTGG + Intronic
1095889899 12:47226352-47226374 ATCTCTTCTCTCAAGAGGAGGGG - Intronic
1098652920 12:72996206-72996228 ATCTGCTCTCTCTATAACCAGGG + Intergenic
1105155866 13:17349072-17349094 AACTGCTCTGTCAATAAGAAAGG - Intergenic
1106661210 13:31801375-31801397 ATCTGCTCTCTCTGTTAAAGGGG - Intronic
1110366297 13:74689707-74689729 ATCTGCTCTCTAAATCCCAGGGG - Intergenic
1110526333 13:76542648-76542670 ATCTACCCTGTCTATAAGAGAGG - Intergenic
1115160193 14:30385140-30385162 ATCTGTTCTCTCCAGAAGGGTGG + Intergenic
1116227024 14:42165595-42165617 TTCTGACCTATCAATAAGAGTGG + Intergenic
1117562901 14:56962025-56962047 ATCATCTCTCTCCATAAGGGAGG - Intergenic
1117671586 14:58112437-58112459 ATCTTATCACTCAATAAGAAGGG + Intronic
1120320175 14:82949733-82949755 ATCTGCTGTCTGAATAAGAATGG - Intergenic
1123411623 15:20065784-20065806 ATATGCTCCCTCCATAACAGAGG - Intergenic
1123520969 15:21072903-21072925 ATATGCTCCCTCCATAACAGAGG - Intergenic
1126346266 15:47697455-47697477 ATCTCCTCTCCCACTAAGAAAGG + Intronic
1127019301 15:54727984-54728006 ATGTACTCTCTGATTAAGAGAGG + Intergenic
1127401998 15:58597707-58597729 AGCTGCTGTTTCAATAAGAAAGG + Intronic
1132435745 15:101800566-101800588 ATTGGCTCACTTAATAAGAGAGG - Intergenic
1133486971 16:6229076-6229098 ACATGGTCTCTCAATAAGATGGG - Intronic
1135292330 16:21250650-21250672 ATCTGCTCTCTCTTGAAGATAGG - Exonic
1136920087 16:34261367-34261389 ATCTGCTCTCTCAAAAGAAAGGG - Intergenic
1137097155 16:36323764-36323786 ATCTGCTCTCTCAAAAGAAAGGG - Intergenic
1139696403 16:68678384-68678406 ATCTGCTCACTGAACAGGAGAGG - Intronic
1145447540 17:23196261-23196283 AACTGCTCTATCAATAGGAATGG - Intergenic
1145489230 17:23802783-23802805 AACTGCTCTATCAATAGGAATGG - Intergenic
1145499035 17:23945814-23945836 AACTGCTCTATCAATAGGATTGG - Intergenic
1145504919 17:24031480-24031502 AACTGCTCTATCAATAGGAATGG - Intergenic
1145508360 17:24081685-24081707 AACTGCTCTATCAATAGGAATGG - Intergenic
1145513660 17:24158526-24158548 AACTGCTCTATCAATAGGAATGG - Intergenic
1145519121 17:24237774-24237796 AACTGCTCTATCAATAGGAATGG - Intergenic
1145525493 17:24330599-24330621 AACTGCTCTATCAATAGGAATGG - Intergenic
1145535809 17:24480701-24480723 AACTGCTCTATCAATAGGAATGG - Intergenic
1145544575 17:24608248-24608270 AACTGCTCTATCAATAGGAATGG - Intergenic
1145550640 17:24696802-24696824 AACTGCTCTATCAATAGGAATGG - Intergenic
1145559565 17:24826400-24826422 AACTGCTCTATCAATAGGAATGG - Intergenic
1145567725 17:24944962-24944984 AACTGCTCTATCAATAGGAATGG - Intergenic
1145573196 17:25024495-25024517 AACTGCTCTATCAATAGGAATGG - Intergenic
1145576720 17:25075885-25075907 AACTGCTCTATCAATAGGAATGG - Intergenic
1145578391 17:25100138-25100160 AACTGCTCTATCAATAGGAATGG - Intergenic
1145581096 17:25139349-25139371 AACTGCTCTATCAATAGGAATGG - Intergenic
1145586158 17:25212826-25212848 AACTGCTCTATCAATAGGAATGG - Intergenic
1145589759 17:25264907-25264929 AACTGCTCTATCAATAGGAATGG - Intergenic
1145594180 17:25329370-25329392 AACTGCTCTATCAATAGGAATGG - Intergenic
1145599614 17:25409120-25409142 AACTGCTCTATCAATAGGAATGG - Intergenic
1145610150 17:25562512-25562534 AACTGCTCTATCAATAGGAATGG - Intergenic
1145624434 17:25770546-25770568 AACTGCTCTATCAATAGGAATGG - Intergenic
1145625801 17:25790565-25790587 AACTGCTCTATCAATAGGAATGG - Intergenic
1145629436 17:25843348-25843370 AACTGCTCTATCAATAGGAATGG - Intergenic
1145630174 17:25854209-25854231 AACTGCTCTATCAATAGGAATGG - Intergenic
1145630717 17:25862185-25862207 AACTGCTCTATCAATAGGAATGG - Intergenic
1145630907 17:25864900-25864922 AACTGCTCTATCAATAGGAATGG - Intergenic
1145632530 17:25888494-25888516 AACTGCTCTATCAATAGGAATGG - Intergenic
1145637924 17:25966076-25966098 AACTGCTCTATCAATAGGAATGG - Intergenic
1145643741 17:26050759-26050781 AACTGCTCTATCAATAGGAATGG - Intergenic
1145653356 17:26190057-26190079 AACTGCTCTATCAATAGGAATGG - Intergenic
1145655412 17:26219920-26219942 AACTGCTCTATCAATAGGAATGG - Intergenic
1145662292 17:26319884-26319906 AACTGCTCTATCAATAGGAATGG - Intergenic
1145666328 17:26378612-26378634 AACTGCTCTATCAATAGGAATGG - Intergenic
1145672604 17:26469927-26469949 AACTGCTCTATCAATAGGATTGG - Intergenic
1145681841 17:26604137-26604159 AACTGCTCTATCAATAGGAATGG - Intergenic
1146953504 17:36922515-36922537 AGCTGCTCCCTCAATAATAGTGG + Intergenic
1154294953 18:13139686-13139708 AGCTGCTCTCTCTAGAGGAGTGG + Intergenic
1155793367 18:30002110-30002132 ATCTGCTCTCTCAATAACAAGGG + Intergenic
1156661806 18:39355084-39355106 TTCTGCTCCCACAAAAAGAGAGG - Intergenic
1156873204 18:41972805-41972827 AACTGCTATATCAAGAAGAGGGG - Intronic
1164344930 19:24908426-24908448 ATCTGCTCTGTCTAAAAGAAGGG - Intergenic
925706907 2:6694341-6694363 ATCTCTTCTCTCAAGAAGCGTGG - Intergenic
926254573 2:11179679-11179701 ATTTGCTTTCTCTATAAGATGGG - Intergenic
926645132 2:15282721-15282743 ATCTGCTGTCTAAATAAGAAGGG + Intronic
928489115 2:31762840-31762862 ATCTGCTATATCACTAAGTGAGG + Intergenic
929073158 2:38054884-38054906 CTCTGCTCTCTCAAAAGGACGGG + Intronic
930450222 2:51526402-51526424 ATCTGCACTATCATAAAGAGCGG + Intergenic
938228558 2:129638235-129638257 ATTTTCTCTCTCATTCAGAGTGG + Intergenic
939096162 2:137835976-137835998 ATCAGATGTCTCAGTAAGAGAGG - Intergenic
941582446 2:167316430-167316452 ACCTGCTATCTAAAGAAGAGTGG + Intergenic
941641503 2:167993726-167993748 AACTGCACTTTCAATTAGAGTGG - Intronic
945943211 2:215970173-215970195 AACTGCTTTCCCAATAAGAAGGG + Intronic
1171181043 20:23090578-23090600 ATCTGCTCTCTAAATAAAATGGG - Intergenic
1171741891 20:28905083-28905105 ATCTGCTCTATCAAAAAGAAAGG - Intergenic
1178690828 21:34748201-34748223 ATCTGTTCTCTCAGCAAGCGAGG - Intergenic
951620425 3:24595561-24595583 ATATGAAGTCTCAATAAGAGAGG + Intergenic
952316202 3:32234783-32234805 ACCTGCTCTCTGAGAAAGAGAGG - Intergenic
953457738 3:43056007-43056029 ACCTGCTATCTCACTAACAGAGG - Intronic
953478910 3:43232341-43232363 ATCTTATCGCTCAATAAGAGGGG + Intergenic
958220092 3:90659017-90659039 AACTGCTCTATCAAAAAGAAAGG + Intergenic
960035683 3:113100889-113100911 TTCTGCTCTCTCATTAAGAATGG + Intergenic
964414451 3:156432788-156432810 AACTGCTCTCTGAAGAATAGAGG + Intronic
964874411 3:161349938-161349960 ATCTCCTCTCTCAGATAGAGAGG + Intronic
967632383 3:191760224-191760246 ATTTGCTCTCTTAATTAGAATGG + Intergenic
968209392 3:196835856-196835878 ATCTGCTCCCGCAATATCAGAGG - Intergenic
970762522 4:19508246-19508268 ATCAGCTCTCTTAATCATAGTGG + Intergenic
976567245 4:86565032-86565054 AGCTGCACTCTCAACAGGAGTGG - Intronic
977839687 4:101687502-101687524 ATCTTCTCACTCAATAAAATTGG + Intronic
977914577 4:102577304-102577326 CTCTGCTCTCTGAATAACTGAGG + Intronic
978482230 4:109206322-109206344 ATCTTCTCTCTCCATAAAAATGG + Intronic
980239213 4:130151699-130151721 ATCAGCTCACTCAATTAGAATGG + Intergenic
984034813 4:174651953-174651975 GTCTGCTCTCGCAGTAAGACAGG + Intronic
989904627 5:47233729-47233751 ATCTGCTCTGTCTAAAAGAAGGG - Intergenic
989906519 5:47264664-47264686 ATCTGCTCTGTCTAAAAGAAGGG - Intergenic
989907019 5:47272829-47272851 ATCTGCTCTGTCTAAAAGAAGGG - Intergenic
993199594 5:84797162-84797184 ATCTTCTCTCTCAGTGTGAGAGG - Intergenic
1001022276 5:168193386-168193408 ATCTGCTCTATAAATTATAGTGG - Intronic
1002087347 5:176784565-176784587 AGCTGCTCGCTCACTCAGAGGGG - Intergenic
1003844804 6:10161906-10161928 ATCTTCTCTACCAATAAGAGGGG + Intronic
1006748979 6:36364783-36364805 CTGTCATCTCTCAATAAGAGAGG + Intronic
1007039032 6:38704351-38704373 AGCTGTTCTCTCACTAGGAGTGG + Intergenic
1008105121 6:47432785-47432807 ACCTCCTCTCTGGATAAGAGGGG + Intergenic
1013045525 6:106481493-106481515 ATCTCCTCTCTCTGAAAGAGAGG + Intergenic
1018605830 6:165596783-165596805 GTCTGCTCTCTGAGTAAGACAGG - Intronic
1020427067 7:8079211-8079233 TTGTGGTCTCCCAATAAGAGAGG - Intronic
1022648688 7:32255293-32255315 TGCTGCTCTCTCAGTGAGAGAGG - Intronic
1028798220 7:94929718-94929740 ATCTCCACTCTCTATTAGAGTGG - Intronic
1029638175 7:101799539-101799561 ATTTACTCTCAAAATAAGAGTGG + Intergenic
1030978061 7:116152014-116152036 CTCTGCACCCTCAATAAGAAAGG - Intronic
1033468133 7:141616180-141616202 CTCTGCTCTTTCAAGAAGATAGG + Intronic
1034443987 7:151102459-151102481 ATCTGCTATCTCAGAAAGAATGG + Intronic
1039786717 8:40840596-40840618 ATCTGCTCTCTGACTAACGGAGG - Intronic
1043146018 8:76655292-76655314 ATTTTCTCTTTCAATAAAAGAGG - Intergenic
1045711618 8:104991168-104991190 ATCTGCTTTCTCTATAAAAATGG - Intronic
1046818359 8:118609855-118609877 CTCTGCTCTGTCTATCAGAGGGG - Intronic
1049335325 8:142081509-142081531 CTTTGCTCTCTCTGTAAGAGTGG - Intergenic
1049636401 8:143691833-143691855 AGCTGCTCTCTAAATTAGACAGG + Intronic
1050246748 9:3697988-3698010 ATCCCCTCTTTAAATAAGAGGGG + Intergenic
1052399415 9:27981656-27981678 ATCTGCTCTCTCAATAAGAGGGG - Intronic
1053281407 9:36822202-36822224 ACGTGTTTTCTCAATAAGAGAGG + Intergenic
1056139969 9:83666630-83666652 ATATTCTCTCTCAATGAGAATGG + Intronic
1056512459 9:87318929-87318951 ATCTGGTCCCTCAATTAGATCGG + Intergenic
1059497157 9:114719314-114719336 ATTGGCTCTCTCAATACGTGAGG + Intergenic
1060411601 9:123403970-123403992 TTTTCCTCTCTAAATAAGAGAGG + Intronic
1203383359 Un_KI270435v1:85655-85677 ATCTGCTCTATCAAAAAGAAAGG + Intergenic
1186209423 X:7233943-7233965 ATCTGCGCTGTCAATATCAGAGG - Intronic
1186592623 X:10947249-10947271 ATTTACTCTCACAATCAGAGAGG + Intergenic
1188734756 X:33699162-33699184 AACTGTTCTCTAAATAACAGAGG - Intergenic
1189801052 X:44692221-44692243 ATCTGCTCACTCAATATGACAGG - Intergenic
1190855544 X:54290759-54290781 AGATACTCTCTCAAGAAGAGAGG + Intronic
1197802918 X:130371076-130371098 ATCTGCTATATCATGAAGAGAGG - Intronic
1201081537 Y:10255869-10255891 AACTGCTCTGTCAAAAAAAGAGG + Intergenic
1201096101 Y:10617446-10617468 AACTGCTCTGTCAAAAAAAGAGG + Intergenic
1201577024 Y:15471807-15471829 ATCTGATATCTCAAAAAGAATGG - Intergenic
1201623916 Y:15992190-15992212 ATCTGCTCCATCACCAAGAGCGG - Intergenic
1201990353 Y:20017072-20017094 TTCTACTCTCTCAAAAAGTGGGG + Intergenic