ID: 1052399416

View in Genome Browser
Species Human (GRCh38)
Location 9:27981657-27981679
Sequence GATCTGCTCTCTCAATAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1771
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 1739}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052399416_1052399418 4 Left 1052399416 9:27981657-27981679 CCCTCTTATTGAGAGAGCAGATC 0: 1
1: 0
2: 1
3: 30
4: 1739
Right 1052399418 9:27981684-27981706 TTGTCCATCTAGATTAGTGAAGG No data
1052399416_1052399420 23 Left 1052399416 9:27981657-27981679 CCCTCTTATTGAGAGAGCAGATC 0: 1
1: 0
2: 1
3: 30
4: 1739
Right 1052399420 9:27981703-27981725 AAGGTCCAGAAAGAAAAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052399416 Original CRISPR GATCTGCTCTCTCAATAAGA GGG (reversed) Intronic
900769649 1:4530527-4530549 GATCTGGTCTCAAAATCAGAAGG + Intergenic
901272141 1:7960831-7960853 GATCTGTGCTCTCCTTAAGAGGG + Intronic
901962728 1:12840302-12840324 AAAGTGCTCTCTCAATAAAACGG - Intergenic
901969289 1:12894788-12894810 AAAGTGCTCTCTCAATAAAACGG - Exonic
901989917 1:13104605-13104627 AAAGTGCTCTCTCAATAAAACGG - Intergenic
902015883 1:13306992-13307014 AAAGTGCTCTCTCAATAAAACGG + Intronic
910641972 1:89473438-89473460 GCTCTGATCTCCCCATAAGATGG + Intergenic
913888531 1:124275452-124275474 AATCTGCTCTCTCTAAATGAAGG - Intergenic
913929809 1:124941975-124941997 AAACTGCTCTCTCAAAAGGATGG + Intergenic
913929926 1:124944362-124944384 AAACTGCTCTCTCAAAAGGAAGG + Intergenic
913930032 1:124946576-124946598 AATCTGCTCTCTCAAAAGCATGG + Intergenic
913930055 1:124947084-124947106 AAACTGCTCTCTCAAAAGGAAGG + Intergenic
913930112 1:124948275-124948297 AAACTGCTCTCTCAAAAGGAAGG + Intergenic
913930156 1:124949293-124949315 AAACTGCTCTCTCAAAAGGAAGG + Intergenic
913930191 1:124949974-124949996 AAACTGCTCTCTCAAAAGGAAGG + Intergenic
913930206 1:124950486-124950508 AATCTGCTCTCTCAAAAGGATGG + Intergenic
913930254 1:124951341-124951363 AAACTGCTCTCTCAAAAGGAAGG + Intergenic
913930277 1:124951852-124951874 AAACTGCTCTCTCAAAAGGAAGG + Intergenic
913930341 1:124953042-124953064 AATCTTCTCTCTCAAAAGGAAGG + Intergenic
913930421 1:124954917-124954939 AAACTGCTCTCTCAAAAGGAAGG + Intergenic
913930454 1:124955599-124955621 AAACTGCTCTCTCAAAAGGAAGG + Intergenic
913930721 1:124961398-124961420 AAACTGCTCTCTCAAAACGAAGG + Intergenic
913931406 1:124968456-124968478 AAACTGCTCTCTCAAAAGGAAGG + Intergenic
913931463 1:124969648-124969670 AAACTGCTCTCTCAAAAGGAAGG + Intergenic
913931510 1:124970668-124970690 AAACTGCTCTCTCAAAAGGAAGG + Intergenic
913931634 1:124973566-124973588 AAACTGCTCTCTCAAAAGGAAGG + Intergenic
913931667 1:124974248-124974270 AAACTGCTCTCTCAAAAGGAAGG + Intergenic
913931748 1:124976123-124976145 AAACTGCTCTCTCAAAAGGAAGG + Intergenic
913932060 1:124983445-124983467 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
913932068 1:124983617-124983639 AAACAGCTCTCTCAATAGGAAGG - Intergenic
913932206 1:124986347-124986369 AAACTGCTCTCTCAAAAAGAAGG + Intergenic
913932421 1:124991124-124991146 AAACTGCTCTCTCAAAAGGAAGG + Intergenic
913932446 1:124991804-124991826 AAACTGCTCTCTCAAAAGGAAGG + Intergenic
913932491 1:124992843-124992865 AAACTGCTCTCTCAAAAGGAAGG + Intergenic
913932769 1:124998461-124998483 AAACTGCTCTCTCAAAAGGAAGG + Intergenic
913933094 1:125004552-125004574 GAACTGCTCTATCAAAACGAAGG - Intergenic
913933232 1:125007101-125007123 AATCTGCTCTATCAAAAGGAAGG - Intergenic
913934635 1:125023324-125023346 AAACTGCTCTATCAATAGGAAGG - Intergenic
913935399 1:125037142-125037164 AAACTGCTCTATCAAAAAGAAGG - Intergenic
913936347 1:125054562-125054584 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
913936394 1:125055412-125055434 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
913936416 1:125055924-125055946 AAACTGCTCTCTCAAAAAGAAGG - Intergenic
913936496 1:125057628-125057650 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
913936600 1:125059674-125059696 AATCTGCTCTATCAAAAGGATGG - Intergenic
920450714 1:206059288-206059310 GGTCAGCTCTCTCACTCAGAAGG + Intronic
1063826285 10:9901496-9901518 GAACTGCTCAATCAAGAAGAAGG - Intergenic
1064337415 10:14456448-14456470 GGTCTCCTCTCTCAATCACAGGG - Intronic
1066440332 10:35432617-35432639 GATTGTCTCTCTCAATAAGATGG - Intronic
1066821652 10:39500195-39500217 GAACTGCTCTGTCAATAGGAAGG - Intergenic
1066821882 10:39504445-39504467 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
1066822965 10:39519078-39519100 AATCTGCTCTATCAAAAGGAAGG - Intergenic
1066823159 10:39522734-39522756 AATCTGCTCTATCAAAAGGAAGG - Intergenic
1066823580 10:39530649-39530671 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
1066825202 10:39562903-39562925 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066825462 10:39567985-39568007 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066825529 10:39569342-39569364 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066825798 10:39573951-39573973 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066825864 10:39575308-39575330 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066825939 10:39576663-39576685 CATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066826223 10:39582088-39582110 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066826450 10:39591598-39591620 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066826540 10:39597695-39597717 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066826655 10:39600015-39600037 GATCTGCTCTCTCCAAAGAAAGG - Intergenic
1066827143 10:39609128-39609150 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066827272 10:39611840-39611862 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066827666 10:39621813-39621835 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066827744 10:39626346-39626368 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066827825 10:39628042-39628064 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066827997 10:39631432-39631454 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066828074 10:39633113-39633135 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066828220 10:39636111-39636133 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066842171 10:39938259-39938281 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066842240 10:39939616-39939638 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066842308 10:39940973-39940995 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066842376 10:39942330-39942352 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066842491 10:39944709-39944731 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066842508 10:39945047-39945069 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066842614 10:39947086-39947108 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066842751 10:39949799-39949821 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066842816 10:39951158-39951180 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066842886 10:39952512-39952534 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066842956 10:39953870-39953892 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066843026 10:39955227-39955249 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066843090 10:39956585-39956607 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066843162 10:39957945-39957967 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066843228 10:39959303-39959325 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066843303 10:39960662-39960684 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066843442 10:39963376-39963398 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066843511 10:39964734-39964756 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066843575 10:39966091-39966113 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066843641 10:39967446-39967468 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066843763 10:39969824-39969846 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066843833 10:39971178-39971200 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066843953 10:39973554-39973576 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066844093 10:39976271-39976293 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066844145 10:39977292-39977314 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066844166 10:39977633-39977655 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066844233 10:39978991-39979013 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066844300 10:39980350-39980372 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066844420 10:39982732-39982754 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066844539 10:39985108-39985130 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066844611 10:39986468-39986490 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066844732 10:39988847-39988869 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066844939 10:39992922-39992944 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066845010 10:39994279-39994301 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066845029 10:39994617-39994639 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066845097 10:39995975-39995997 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066845250 10:39999033-39999055 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066845520 10:40004463-40004485 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066845593 10:40005820-40005842 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066845612 10:40006158-40006180 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066845667 10:40007178-40007200 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066845686 10:40007516-40007538 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066845750 10:40008875-40008897 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066845818 10:40010219-40010241 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066845884 10:40011577-40011599 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066845936 10:40012597-40012619 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066845956 10:40012935-40012957 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066846045 10:40014632-40014654 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066846113 10:40015990-40016012 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066846184 10:40017348-40017370 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066846284 10:40019387-40019409 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066846391 10:40021424-40021446 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066846409 10:40021762-40021784 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066846478 10:40023120-40023142 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066846534 10:40024139-40024161 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066846673 10:40026856-40026878 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066846741 10:40028214-40028236 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066846806 10:40029572-40029594 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066846880 10:40030930-40030952 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066846947 10:40032288-40032310 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066847015 10:40033646-40033668 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066847082 10:40035004-40035026 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066847135 10:40036024-40036046 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066847155 10:40036362-40036384 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066847225 10:40037720-40037742 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066847291 10:40039078-40039100 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066847360 10:40040437-40040459 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066847430 10:40041795-40041817 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066847498 10:40043152-40043174 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066847571 10:40044508-40044530 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066847639 10:40045866-40045888 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066847773 10:40048583-40048605 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066847842 10:40049941-40049963 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066847914 10:40051299-40051321 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066847978 10:40052657-40052679 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066848045 10:40054015-40054037 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066848110 10:40055373-40055395 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066848176 10:40056731-40056753 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066848244 10:40058089-40058111 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066848384 10:40060807-40060829 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066848454 10:40062164-40062186 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066848587 10:40064880-40064902 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066848656 10:40066240-40066262 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066848758 10:40068278-40068300 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066848879 10:40070654-40070676 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066848944 10:40072012-40072034 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066849017 10:40073369-40073391 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066849154 10:40076086-40076108 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066849275 10:40078463-40078485 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066849340 10:40079820-40079842 AATCTGCTCTCTCTAAACGAAGG - Intergenic
1066849359 10:40080158-40080180 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066849651 10:40085929-40085951 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066849685 10:40086607-40086629 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066849768 10:40088304-40088326 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066849970 10:40092377-40092399 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066850041 10:40093735-40093757 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066850300 10:40098832-40098854 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066850352 10:40099849-40099871 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066850451 10:40101886-40101908 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066850518 10:40103245-40103267 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066850586 10:40104603-40104625 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066850704 10:40106982-40107004 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066850755 10:40108000-40108022 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066850877 10:40110377-40110399 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066850948 10:40111731-40111753 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066851050 10:40113768-40113790 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066851117 10:40115127-40115149 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066851183 10:40116485-40116507 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066851249 10:40117843-40117865 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066851316 10:40119200-40119222 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066851383 10:40120558-40120580 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066851453 10:40121916-40121938 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066851521 10:40123274-40123296 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066851553 10:40123952-40123974 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066851692 10:40126668-40126690 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066851930 10:40131428-40131450 AATCTGCTCTCTCTATAGGAAGG - Intergenic
1066851999 10:40132782-40132804 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066852071 10:40134139-40134161 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066852376 10:40140251-40140273 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066852444 10:40141609-40141631 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066852560 10:40143988-40144010 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066852628 10:40145346-40145368 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066852751 10:40147721-40147743 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066852822 10:40149078-40149100 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066852941 10:40151458-40151480 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066853009 10:40152816-40152838 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066853079 10:40154174-40154196 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066853150 10:40155532-40155554 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066853387 10:40160288-40160310 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066853458 10:40161646-40161668 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066853627 10:40165043-40165065 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066853744 10:40167422-40167444 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066853810 10:40168781-40168803 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066853866 10:40169802-40169824 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066853937 10:40171160-40171182 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066854005 10:40172519-40172541 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066854207 10:40176598-40176620 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066854275 10:40177955-40177977 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066854341 10:40179313-40179335 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066854428 10:40181013-40181035 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066854495 10:40182369-40182391 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066854565 10:40183727-40183749 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066854637 10:40185086-40185108 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066854782 10:40187801-40187823 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066854853 10:40189159-40189181 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066854921 10:40190517-40190539 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066855023 10:40192559-40192581 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066855073 10:40193577-40193599 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066855197 10:40195953-40195975 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066855265 10:40197311-40197333 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066855335 10:40198668-40198690 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066855405 10:40200026-40200048 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066855477 10:40201384-40201406 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066855752 10:40206823-40206845 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066855899 10:40209880-40209902 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066855969 10:40211238-40211260 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066856037 10:40212596-40212618 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066856106 10:40213954-40213976 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066856174 10:40215312-40215334 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066856324 10:40218371-40218393 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066856375 10:40219391-40219413 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066856684 10:40225503-40225525 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066856871 10:40229238-40229260 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066856940 10:40230596-40230618 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066857060 10:40232972-40232994 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066857113 10:40233991-40234013 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066857181 10:40235349-40235371 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066857247 10:40236707-40236729 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066857349 10:40238745-40238767 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066857418 10:40240103-40240125 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066857518 10:40242140-40242162 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066857656 10:40244858-40244880 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066857889 10:40249610-40249632 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066857960 10:40250968-40250990 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066858027 10:40252327-40252349 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066858099 10:40253685-40253707 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066858168 10:40255044-40255066 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066858307 10:40257763-40257785 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066858375 10:40259124-40259146 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066858394 10:40259462-40259484 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066858464 10:40260819-40260841 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066858532 10:40262177-40262199 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066858648 10:40264554-40264576 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066858774 10:40266929-40266951 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066858925 10:40269986-40270008 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066859029 10:40272024-40272046 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066859095 10:40273384-40273406 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066859161 10:40274742-40274764 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066859229 10:40276100-40276122 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066859303 10:40277458-40277480 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066859406 10:40279492-40279514 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066859522 10:40281869-40281891 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066859591 10:40283226-40283248 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066859832 10:40287979-40288001 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066859954 10:40290356-40290378 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066860020 10:40291716-40291738 TATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066860088 10:40293074-40293096 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066860157 10:40294432-40294454 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066860224 10:40295790-40295812 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066860294 10:40297148-40297170 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066860361 10:40298504-40298526 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066860428 10:40299862-40299884 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066860447 10:40300200-40300222 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066860517 10:40301560-40301582 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066860651 10:40304276-40304298 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066860722 10:40305634-40305656 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066860790 10:40306992-40307014 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066860861 10:40308351-40308373 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066860928 10:40309708-40309730 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066861129 10:40313782-40313804 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066861201 10:40315140-40315162 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066861253 10:40316159-40316181 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066861317 10:40317518-40317540 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066861386 10:40318874-40318896 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066861454 10:40320232-40320254 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066861523 10:40321586-40321608 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066861590 10:40322944-40322966 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066861658 10:40324302-40324324 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066861778 10:40326681-40326703 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066861849 10:40328039-40328061 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066862064 10:40332453-40332475 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066862133 10:40333811-40333833 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066862196 10:40335169-40335191 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066862267 10:40336527-40336549 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066862400 10:40339243-40339265 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066862457 10:40340262-40340284 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066862494 10:40340938-40340960 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066862854 10:40348071-40348093 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066862920 10:40349429-40349451 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066862989 10:40350787-40350809 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066863111 10:40353163-40353185 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066863179 10:40354521-40354543 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066863248 10:40355878-40355900 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066863316 10:40357237-40357259 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066863383 10:40358595-40358617 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066863450 10:40359953-40359975 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066863520 10:40361311-40361333 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066863635 10:40363687-40363709 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066863733 10:40365721-40365743 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066863803 10:40367078-40367100 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066864137 10:40373865-40373887 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066864157 10:40374203-40374225 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066864328 10:40377598-40377620 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066864395 10:40378957-40378979 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066864464 10:40380315-40380337 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066864530 10:40381673-40381695 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066864598 10:40383031-40383053 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066864671 10:40384389-40384411 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066864770 10:40386429-40386451 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066864870 10:40388470-40388492 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066865445 10:40400022-40400044 AATCTGCTCTCTCTAAATGAAGG - Intergenic
1066865495 10:40401041-40401063 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066865563 10:40402399-40402421 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066865632 10:40403757-40403779 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066865749 10:40406133-40406155 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066865930 10:40409866-40409888 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066866241 10:40415977-40415999 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066866305 10:40417335-40417357 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066866426 10:40419713-40419735 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066866494 10:40421071-40421093 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066866633 10:40423788-40423810 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066866705 10:40425146-40425168 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066866777 10:40426504-40426526 TATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066866861 10:40428205-40428227 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066866932 10:40429563-40429585 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066866982 10:40430580-40430602 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066867052 10:40431938-40431960 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066867119 10:40433296-40433318 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066867189 10:40434654-40434676 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066867261 10:40436012-40436034 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066867315 10:40437033-40437055 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066867366 10:40438048-40438070 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066867434 10:40439406-40439428 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066867608 10:40442802-40442824 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066867626 10:40443140-40443162 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066867646 10:40443478-40443500 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066867711 10:40444836-40444858 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066867961 10:40449929-40449951 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066868030 10:40451287-40451309 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066868099 10:40452645-40452667 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066868432 10:40459444-40459466 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066868498 10:40460803-40460825 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066868572 10:40462158-40462180 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066868687 10:40464535-40464557 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066868834 10:40467250-40467272 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066868901 10:40468607-40468629 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066868953 10:40469629-40469651 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066869023 10:40470987-40471009 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066869093 10:40472345-40472367 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066869113 10:40472683-40472705 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066869166 10:40473703-40473725 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066869270 10:40475742-40475764 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066869552 10:40481519-40481541 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066869620 10:40482877-40482899 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066869722 10:40484913-40484935 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066869843 10:40487290-40487312 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066870018 10:40490682-40490704 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066870068 10:40491700-40491722 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066870121 10:40492719-40492741 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066870265 10:40495526-40495548 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066870389 10:40497899-40497921 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066870529 10:40500617-40500639 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066870769 10:40505368-40505390 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066870821 10:40506387-40506409 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066870891 10:40507744-40507766 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066870962 10:40509101-40509123 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066871046 10:40510797-40510819 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066871212 10:40514196-40514218 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066871423 10:40518275-40518297 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066871596 10:40521672-40521694 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066871663 10:40523030-40523052 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066871847 10:40526763-40526785 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066871864 10:40527101-40527123 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066871933 10:40528459-40528481 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066872000 10:40529817-40529839 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066872168 10:40533211-40533233 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066872223 10:40534232-40534254 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066872242 10:40534570-40534592 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066872310 10:40535928-40535950 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066872328 10:40536266-40536288 TATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066872395 10:40537624-40537646 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066872570 10:40541018-40541040 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066872704 10:40543734-40543756 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066872800 10:40545772-40545794 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066872972 10:40549166-40549188 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066873061 10:40550858-40550880 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066873128 10:40552218-40552240 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066873197 10:40553576-40553598 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066873264 10:40554935-40554957 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066873442 10:40558671-40558693 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066873511 10:40560029-40560051 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066873698 10:40563764-40563786 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066873765 10:40565122-40565144 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066873834 10:40566480-40566502 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066873905 10:40567838-40567860 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066873922 10:40568176-40568198 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066873994 10:40569535-40569557 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066874062 10:40570894-40570916 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066874127 10:40572253-40572275 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066874196 10:40573611-40573633 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066874384 10:40577345-40577367 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066874542 10:40580403-40580425 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066874796 10:40585136-40585158 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066874916 10:40587512-40587534 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066875018 10:40589549-40589571 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066875139 10:40591925-40591947 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066875311 10:40595320-40595342 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066875379 10:40596677-40596699 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066875598 10:40601091-40601113 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066875749 10:40604149-40604171 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066875971 10:40608559-40608581 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066876203 10:40613315-40613337 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066876270 10:40614674-40614696 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066876340 10:40616031-40616053 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066876409 10:40617386-40617408 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066876532 10:40619763-40619785 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066876600 10:40621120-40621142 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066876752 10:40624176-40624198 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066876819 10:40625534-40625556 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066876886 10:40626892-40626914 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066876970 10:40628590-40628612 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066877035 10:40629948-40629970 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066877139 10:40631986-40632008 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066877206 10:40633344-40633366 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066877274 10:40634701-40634723 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066877340 10:40636059-40636081 AATCTGCTCTCTCTAAACGAAGG - Intergenic
1066877405 10:40637418-40637440 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066877622 10:40641831-40641853 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066877722 10:40643871-40643893 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066877874 10:40646929-40646951 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066877976 10:40648966-40648988 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066878156 10:40652365-40652387 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066878225 10:40653722-40653744 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066878294 10:40655078-40655100 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066878649 10:40662207-40662229 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066878715 10:40663564-40663586 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066878786 10:40664922-40664944 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066878888 10:40666959-40666981 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066878904 10:40667299-40667321 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066878975 10:40668657-40668679 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066879172 10:40672737-40672759 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066879344 10:40676131-40676153 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066879572 10:40680544-40680566 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066879708 10:40683259-40683281 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066880081 10:40690729-40690751 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066880184 10:40692766-40692788 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066880272 10:40694452-40694474 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066880341 10:40695810-40695832 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066880408 10:40697168-40697190 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066880474 10:40698526-40698548 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066880610 10:40701242-40701264 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066880732 10:40703618-40703640 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066881364 10:40716183-40716205 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066881568 10:40720259-40720281 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066881621 10:40721279-40721301 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066881847 10:40724359-40724381 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066881916 10:40725716-40725738 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066882019 10:40727752-40727774 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066882243 10:40732169-40732191 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066882345 10:40734208-40734230 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066882481 10:40736922-40736944 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066882686 10:40740999-40741021 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066882761 10:40742355-40742377 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066882828 10:40743713-40743735 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066883017 10:40747446-40747468 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066883274 10:40752538-40752560 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066883395 10:40754911-40754933 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066883443 10:40755931-40755953 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066883743 10:40762038-40762060 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066883797 10:40763059-40763081 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066884270 10:40772570-40772592 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066884373 10:40774607-40774629 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066884423 10:40775626-40775648 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066884476 10:40776647-40776669 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066884543 10:40778005-40778027 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066884599 10:40779025-40779047 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066884667 10:40780384-40780406 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066884905 10:40785142-40785164 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066885288 10:40792612-40792634 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066885804 10:40802804-40802826 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066885930 10:40805181-40805203 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066886111 10:40808575-40808597 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066886524 10:40816721-40816743 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066886609 10:40818416-40818438 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066886849 10:40823176-40823198 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066887214 10:40830643-40830665 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066887438 10:40835059-40835081 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066887509 10:40836416-40836438 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066887563 10:40837434-40837456 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066887760 10:40841511-40841533 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066888071 10:40847623-40847645 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066888276 10:40851693-40851715 AATCTGCTCTCTCTAAAAGAAGG - Intergenic
1066888346 10:40853051-40853073 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066888576 10:40857791-40857813 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066888696 10:40860165-40860187 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066888902 10:40864238-40864260 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066889053 10:40867295-40867317 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066889178 10:40869672-40869694 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066889250 10:40871029-40871051 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066889557 10:40877145-40877167 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066889610 10:40878164-40878186 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066889682 10:40879523-40879545 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066889753 10:40880881-40880903 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066889825 10:40882235-40882257 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066890138 10:40888346-40888368 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066890458 10:40894800-40894822 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066890550 10:40896495-40896517 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066890570 10:40896833-40896855 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066890624 10:40897852-40897874 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066890992 10:40904982-40905004 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066891160 10:40908377-40908399 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066891179 10:40908715-40908737 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066891229 10:40909735-40909757 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066891396 10:40913130-40913152 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066891517 10:40915508-40915530 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066891670 10:40918562-40918584 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066891720 10:40919581-40919603 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066891885 10:40922974-40922996 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066892041 10:40926035-40926057 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066892092 10:40927054-40927076 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066892346 10:40931625-40931647 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066892624 10:40937397-40937419 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066892660 10:40938075-40938097 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066892896 10:40942820-40942842 TATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066892997 10:40944858-40944880 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066893049 10:40945875-40945897 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066893121 10:40947232-40947254 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066893223 10:40949267-40949289 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066893538 10:40955382-40955404 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066893913 10:40962858-40962880 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066893994 10:40964556-40964578 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066894111 10:40966936-40966958 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066894163 10:40967953-40967975 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066894215 10:40968972-40968994 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066894670 10:40978143-40978165 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066894722 10:40979162-40979184 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066894878 10:40982219-40982241 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066895589 10:40996489-40996511 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066895639 10:40997510-40997532 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066895690 10:40998530-40998552 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066895909 10:41002941-41002963 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066895965 10:41003959-41003981 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066896040 10:41005315-41005337 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066896092 10:41006335-41006357 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066896161 10:41007694-41007716 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066896267 10:41009727-41009749 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066896410 10:41012441-41012463 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066896514 10:41014480-41014502 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066896966 10:41023314-41023336 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066897035 10:41024672-41024694 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066897187 10:41027727-41027749 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066897355 10:41031121-41031143 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066897712 10:41038254-41038276 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066897969 10:41043347-41043369 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066898131 10:41046405-41046427 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066898285 10:41049460-41049482 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066898351 10:41050817-41050839 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066898524 10:41054213-41054235 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066898544 10:41054551-41054573 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066898649 10:41056588-41056610 GATCTGCTCTCTCCAAAGAAAGG - Intergenic
1066898718 10:41057943-41057965 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066898772 10:41058961-41058983 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066898897 10:41061338-41061360 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066899186 10:41067113-41067135 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066899455 10:41072544-41072566 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066899597 10:41075605-41075627 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066899799 10:41079680-41079702 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066900024 10:41084096-41084118 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066900077 10:41085116-41085138 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066900295 10:41089528-41089550 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066900414 10:41091904-41091926 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066900468 10:41092921-41092943 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066900800 10:41099373-41099395 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066901066 10:41104464-41104486 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066901117 10:41105482-41105504 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066901241 10:41107857-41107879 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066901293 10:41108877-41108899 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066901512 10:41113295-41113317 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066901580 10:41114654-41114676 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066901758 10:41118047-41118069 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066901813 10:41119067-41119089 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066902071 10:41124161-41124183 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066902122 10:41125181-41125203 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066902225 10:41127220-41127242 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066902384 10:41130276-41130298 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066902448 10:41131636-41131658 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066902500 10:41132657-41132679 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066902794 10:41138430-41138452 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066902895 10:41140470-41140492 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066903104 10:41144546-41144568 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066903208 10:41146583-41146605 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066903263 10:41147604-41147626 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066903318 10:41148624-41148646 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066903495 10:41152021-41152043 AATCTGCTCTCTCTAAATGAAGG - Intergenic
1066903601 10:41154060-41154082 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066903655 10:41155080-41155102 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066903707 10:41156099-41156121 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066903830 10:41158472-41158494 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066903931 10:41160513-41160535 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066904053 10:41162887-41162909 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066904280 10:41167305-41167327 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066904439 10:41170363-41170385 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066904594 10:41173417-41173439 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066904647 10:41174437-41174459 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066904713 10:41175794-41175816 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066904839 10:41178172-41178194 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066905096 10:41183266-41183288 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066905198 10:41185306-41185328 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066905295 10:41187344-41187366 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066905415 10:41189721-41189743 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066905572 10:41192776-41192798 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066905632 10:41193792-41193814 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066905681 10:41194810-41194832 TATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066905733 10:41195828-41195850 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066905786 10:41196850-41196872 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066905838 10:41197867-41197889 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066905965 10:41200242-41200264 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066906173 10:41204322-41204344 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066906226 10:41205342-41205364 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066906376 10:41208395-41208417 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066906500 10:41210772-41210794 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066906552 10:41211791-41211813 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066906903 10:41218924-41218946 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066906955 10:41219944-41219966 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066907076 10:41222320-41222342 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066907127 10:41223340-41223362 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066907180 10:41224359-41224381 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066907486 10:41230473-41230495 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066907540 10:41231493-41231515 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066907626 10:41233190-41233212 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066907734 10:41235228-41235250 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066908046 10:41241343-41241365 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066908103 10:41242366-41242388 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066908307 10:41246443-41246465 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066908411 10:41248484-41248506 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066908476 10:41249841-41249863 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066908615 10:41252558-41252580 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066908770 10:41255617-41255639 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066908824 10:41256638-41256660 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066908875 10:41257657-41257679 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066908927 10:41258676-41258698 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066908978 10:41259696-41259718 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066909137 10:41262751-41262773 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066909399 10:41267846-41267868 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066909449 10:41268866-41268888 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066909659 10:41272942-41272964 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066909712 10:41273962-41273984 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066909757 10:41274980-41275002 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066909809 10:41275998-41276020 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066909933 10:41278378-41278400 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066909985 10:41279397-41279419 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066910039 10:41280416-41280438 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066910110 10:41281773-41281795 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066910217 10:41283813-41283835 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066910270 10:41284833-41284855 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066910373 10:41286872-41286894 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066910424 10:41287891-41287913 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066910596 10:41291288-41291310 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066910701 10:41293325-41293347 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066910756 10:41294345-41294367 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066910855 10:41296382-41296404 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066910874 10:41296720-41296742 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066910927 10:41297738-41297760 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066910979 10:41298758-41298780 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066911102 10:41301131-41301153 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066911160 10:41302151-41302173 AATCTGCTCTCTCAAAAGGAAGG - Intergenic
1066911376 10:41306227-41306249 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066911433 10:41307244-41307266 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066911585 10:41310306-41310328 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066911758 10:41313701-41313723 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066911813 10:41314719-41314741 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066911915 10:41316756-41316778 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066912020 10:41318794-41318816 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066912076 10:41319812-41319834 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066912380 10:41325923-41325945 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066912431 10:41326942-41326964 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066912482 10:41327962-41327984 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066912536 10:41328983-41329005 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066912590 10:41330003-41330025 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066912837 10:41335099-41335121 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066912890 10:41336120-41336142 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066912945 10:41337140-41337162 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066913105 10:41340196-41340218 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066913269 10:41343254-41343276 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066913372 10:41345291-41345313 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066913474 10:41347329-41347351 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066913677 10:41351405-41351427 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066913866 10:41355140-41355162 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066914019 10:41358197-41358219 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066914145 10:41360575-41360597 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066914180 10:41361254-41361276 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066914279 10:41363295-41363317 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066914333 10:41364315-41364337 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066914441 10:41366352-41366374 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066914511 10:41367708-41367730 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066914614 10:41369747-41369769 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066914670 10:41370764-41370786 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066914722 10:41371784-41371806 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066914825 10:41373821-41373843 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066914977 10:41376880-41376902 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066915132 10:41379933-41379955 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066915184 10:41380953-41380975 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066915237 10:41381970-41381992 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066915337 10:41384012-41384034 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066915389 10:41385032-41385054 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066915543 10:41388093-41388115 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066915695 10:41391150-41391172 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066915750 10:41392165-41392187 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066915803 10:41393185-41393207 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066915856 10:41394206-41394228 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066915908 10:41395226-41395248 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066915958 10:41396246-41396268 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066916015 10:41397264-41397286 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066916117 10:41399305-41399327 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066916272 10:41402360-41402382 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066916325 10:41403380-41403402 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066916376 10:41404399-41404421 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066916429 10:41405419-41405441 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066916485 10:41406438-41406460 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066916535 10:41407458-41407480 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066916724 10:41411192-41411214 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066916844 10:41413568-41413590 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066917064 10:41417982-41418004 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066917167 10:41420021-41420043 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066917225 10:41421041-41421063 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066917327 10:41423078-41423100 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066917379 10:41424099-41424121 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066917447 10:41425456-41425478 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066917548 10:41427496-41427518 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066917650 10:41429536-41429558 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066917806 10:41432598-41432620 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066917906 10:41434635-41434657 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066918166 10:41439734-41439756 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066918236 10:41441093-41441115 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066918338 10:41443129-41443151 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066918688 10:41450265-41450287 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066918742 10:41451287-41451309 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066918796 10:41452308-41452330 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066919079 10:41457741-41457763 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066919134 10:41458761-41458783 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066919238 10:41460798-41460820 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066919290 10:41461817-41461839 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066919497 10:41465895-41465917 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066919595 10:41467937-41467959 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066919755 10:41470998-41471020 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066919807 10:41472017-41472039 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066919859 10:41473037-41473059 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066919962 10:41475075-41475097 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066920015 10:41476092-41476114 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066920069 10:41477113-41477135 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066920272 10:41481188-41481210 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066920439 10:41484582-41484604 AATCTGCTCTCTCTAAATGAAGG - Intergenic
1066920544 10:41486620-41486642 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066920599 10:41487639-41487661 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066920756 10:41490696-41490718 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066920959 10:41494772-41494794 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066921011 10:41495792-41495814 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066921095 10:41497593-41497615 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066921180 10:41499289-41499311 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066921217 10:41499967-41499989 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066921301 10:41501663-41501685 AATCTGCTCTCTCGAAAGGAAGG - Intergenic
1066921339 10:41502342-41502364 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066921423 10:41504039-41504061 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066921461 10:41504718-41504740 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066921545 10:41506414-41506436 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066921581 10:41507094-41507116 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066921648 10:41508451-41508473 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066921686 10:41509130-41509152 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066921770 10:41510825-41510847 AATCTGCTCTCTCGAAAGGAAGG - Intergenic
1066921807 10:41511504-41511526 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066921888 10:41513200-41513222 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066921925 10:41513879-41513901 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066922014 10:41515575-41515597 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066922051 10:41516254-41516276 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066922135 10:41517950-41517972 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066922172 10:41518629-41518651 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066922238 10:41519985-41520007 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066922275 10:41520664-41520686 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066922364 10:41522361-41522383 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066922401 10:41523040-41523062 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066922484 10:41524736-41524758 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066922519 10:41525415-41525437 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066922588 10:41526772-41526794 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066922627 10:41527451-41527473 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066922863 10:41532201-41532223 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066922951 10:41533897-41533919 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066922988 10:41534576-41534598 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066923069 10:41536272-41536294 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066923226 10:41539326-41539348 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066923309 10:41541021-41541043 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066923346 10:41541700-41541722 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066923428 10:41543396-41543418 AATCTGCTCTCTCGAAAGGAAGG - Intergenic
1066923533 10:41545433-41545455 AATCTGCTCTCTCCAAAGGAAGG - Intergenic
1066923620 10:41547059-41547081 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066923697 10:41548418-41548440 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066923937 10:41552831-41552853 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066924010 10:41554189-41554211 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066924086 10:41555547-41555569 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066924156 10:41556905-41556927 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066924233 10:41558263-41558285 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066924379 10:41560980-41561002 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066924724 10:41567431-41567453 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066924862 10:41570147-41570169 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066924939 10:41571505-41571527 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066925034 10:41573204-41573226 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066925165 10:41575580-41575602 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066925258 10:41577278-41577300 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066925329 10:41578636-41578658 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066925417 10:41580332-41580354 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066925493 10:41581691-41581713 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066925645 10:41584408-41584430 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066925716 10:41585766-41585788 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066925788 10:41587124-41587146 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066925858 10:41588482-41588504 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066925931 10:41589840-41589862 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066926009 10:41591198-41591220 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1066926083 10:41592556-41592578 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1068289592 10:54985269-54985291 GATATGGACTCTCAATAAAAAGG + Intronic
1078228515 11:9416160-9416182 GACCTGGTCTCTTAAAAAGAAGG + Intronic
1079339684 11:19601713-19601735 GATCTTCTCTCTCCATGCGATGG + Intronic
1079559973 11:21810117-21810139 GCTCTGTTCTCTCAACAAGGAGG + Intergenic
1080877696 11:36291545-36291567 GCTCTGCTCTCTGAACTAGATGG - Intergenic
1081586478 11:44388121-44388143 GATGAGCTCTATCAAAAAGAGGG - Intergenic
1082155794 11:48810048-48810070 GAACTGCTCTATCAAAAGGAAGG - Intergenic
1082159189 11:48866803-48866825 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
1082159668 11:48875509-48875531 AAACTGCTCTCTCAATAGGAAGG - Intergenic
1082163455 11:48911144-48911166 AAACTGCTCTATCAAAAAGAAGG + Intergenic
1082163516 11:48912168-48912190 AAACTGCTCTATCAAAAAGAAGG + Intergenic
1082163575 11:48913362-48913384 AAACTGCTCTATCAAAAAGAAGG + Intergenic
1082163762 11:48916767-48916789 AAACTGCTCTATCAAAAAGAAGG + Intergenic
1082163876 11:48918818-48918840 AAACTGCTCTATCAAAAAGAAGG + Intergenic
1082163952 11:48920355-48920377 AAACTGCTCTATCAAAAAGAAGG + Intergenic
1082164097 11:48923088-48923110 AAACTGCTCTATCAAAAAGAAGG + Intergenic
1082164166 11:48924442-48924464 AAACTGCTCTATCAAAAAGAAGG + Intergenic
1082164711 11:48932201-48932223 AAACTGCTCTGTCAAAAAGAAGG + Intergenic
1082164755 11:48933054-48933076 AAACTGCTCTATCAAAAAGAAGG + Intergenic
1082164996 11:48937504-48937526 AAACTGCTCTCTCAAAAGGAAGG + Intergenic
1082165068 11:48938704-48938726 AAACTGCTCTATCAAAAAGAAGG + Intergenic
1082165274 11:48942119-48942141 AAACTGCTCTATCAAAAAGAAGG + Intergenic
1082436850 11:52751850-52751872 GAGCTGCTCTGTCAAGAGGAAGG - Intergenic
1082483472 11:53426190-53426212 GAGCTGCTCTATCAAGAGGAAGG - Intergenic
1082607257 11:55255317-55255339 GAACTGCTCTATCAAAAGGAAGG + Intergenic
1088109176 11:106242325-106242347 TATCTGCTATCTCAAGAAGGAGG - Intergenic
1092799956 12:12154688-12154710 GACCTGATCTCTTAAAAAGAGGG + Intronic
1093168474 12:15832671-15832693 AATCTCATCTCTCAATAAGAGGG - Intronic
1094880067 12:34713186-34713208 AAACTGCTCTATCAAAAAGAGGG + Intergenic
1094899303 12:35089279-35089301 AATCTGCTCTGTCTAAAAGAGGG - Intergenic
1094905595 12:35190830-35190852 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1094910246 12:35265899-35265921 AATCTGCTCTGTCTAAAAGAGGG - Intergenic
1094922064 12:35457477-35457499 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1094924324 12:35494166-35494188 AATCTGCTCTGTCTAAAAGAGGG - Intergenic
1094928728 12:35565316-35565338 AATCTGCTCTGTCTAAAAGAAGG - Intergenic
1094930574 12:35595208-35595230 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1094933348 12:35640376-35640398 AATCTGCTCTGTCTAAAAGAAGG - Intergenic
1094940260 12:35752439-35752461 AATCTGCTCTGTCTAAAAGAAGG - Intergenic
1094944097 12:35814608-35814630 AATCTGCTCTGTCTATAGGAAGG - Intergenic
1094954803 12:35987854-35987876 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1094957910 12:36038124-36038146 AATCTGCTCTGTCTAAAAGAGGG - Intergenic
1094960611 12:36081951-36081973 GATCTGCTCTGTCTAAAGGAAGG - Intergenic
1094969795 12:36230062-36230084 GATCTGCTCTGTCTAAAGGAAGG - Intergenic
1094984827 12:36472967-36472989 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1094984996 12:36475686-36475708 AATCTGCTCTGTCTAAAAGAGGG - Intergenic
1094985501 12:36483843-36483865 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1094989177 12:36543644-36543666 AATCTGCTCTGTCTAAAAGAGGG - Intergenic
1094991480 12:36581008-36581030 AATCTGCTCTGTCTATAGGAAGG - Intergenic
1094992813 12:36602402-36602424 AATCTGCTCTGTCTAAAAGAAGG - Intergenic
1094992961 12:36604778-36604800 AATCTGCTCTGTCTAAAAGAAGG - Intergenic
1094996441 12:36660835-36660857 AATCTGCTCTGTCTAAAAGAGGG - Intergenic
1094997532 12:36678350-36678372 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1095003524 12:36775474-36775496 AATCTGCTCTGTCAAAAGGAAGG - Intergenic
1095010638 12:36891195-36891217 AATCTGCTCTGTCTATAGGAAGG - Intergenic
1095013141 12:36931617-36931639 AATCTGCTCTGTCTAAAAGAGGG - Intergenic
1095019100 12:37027861-37027883 AATCTGCTCTGTCTATAGGAAGG - Intergenic
1095030919 12:37276841-37276863 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
1095031118 12:37281270-37281292 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
1095031603 12:37291648-37291670 AAACTGCTCTCTCAAAAAAAAGG - Intergenic
1095031626 12:37292160-37292182 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
1095031669 12:37293010-37293032 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
1095031804 12:37295906-37295928 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
1095031907 12:37297785-37297807 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
1095032134 12:37302193-37302215 AATCTGCTCTCTCAAAAGGAAGG - Intergenic
1095032175 12:37303045-37303067 AAACTGCTCTCTCAAAAGGATGG - Intergenic
1095032235 12:37304236-37304258 TACCTGCTCTCTCAAAAGGAAGG - Intergenic
1095032245 12:37304407-37304429 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
1095032522 12:37310856-37310878 AAACTGCCCTCTCAATAGGAAGG - Intergenic
1095032763 12:37315617-37315639 GAACTGCTCTCTCAAAAGGATGG - Intergenic
1095033966 12:37333405-37333427 AAACTGCTCTCTCAAAAGGAAGG + Intergenic
1095034139 12:37336726-37336748 AAACTGCTCTCTCAAAAGGAAGG + Intergenic
1095034275 12:37339446-37339468 AAACTGCTCTCTCAAAAGGAAGG + Intergenic
1095034445 12:37342507-37342529 AAACTGCTCTCTCAAAAGGAAGG + Intergenic
1095034656 12:37346233-37346255 AAACTGCTCTCTCAAAAGGAAGG + Intergenic
1095034672 12:37346568-37346590 AAACTGCTCTCTCAAAAGGAAGG + Intergenic
1095035263 12:37358511-37358533 AATCTGCTCTCTCAAAAGGAAGG + Intergenic
1095035675 12:37366764-37366786 AAACTGCTCTCTCAAAAGGAAGG + Intergenic
1095036455 12:37383412-37383434 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
1095036560 12:37385459-37385481 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
1095037176 12:37398362-37398384 AATCTCCTCTCTCAAAAGGAAGG - Intergenic
1095037325 12:37401418-37401440 AAACTGCTCTCTCAAAAATAAGG - Intergenic
1095037353 12:37401927-37401949 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
1095037607 12:37406858-37406880 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
1095037702 12:37408390-37408412 AAACTGCTCTCTCAAAAATAAGG - Intergenic
1095037737 12:37409246-37409268 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
1095037801 12:37410440-37410462 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
1095038065 12:37415506-37415528 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
1095057947 12:37639724-37639746 AAACTGCTCTCTCAAAAGGAAGG + Intergenic
1095057964 12:37640066-37640088 AATCTGCTCTATCAAAAAAAAGG + Intergenic
1095058119 12:37642960-37642982 AATCTACTCTCTCAAAAGGAAGG + Intergenic
1095070340 12:37835597-37835619 GAACTGCTCTCTCAAAAGAATGG - Intergenic
1095072418 12:37869651-37869673 AAACTGCTCTATCAAAAAGAAGG + Intergenic
1098652919 12:72996205-72996227 GATCTGCTCTCTCTATAACCAGG + Intergenic
1099698380 12:86052228-86052250 GATTTGCTGCCTCAAAAAGAGGG + Intronic
1104064665 12:125297006-125297028 GCTCTGCTCTCTCAGAAGGACGG - Intronic
1105094127 13:16340406-16340428 AAACTGCTCTGTCAAAAAGAAGG - Intergenic
1105094262 13:16342454-16342476 AATCTGCTCTGTCAATAGAAAGG - Intergenic
1105095915 13:16369743-16369765 AAACTGCTCTCTCAATAGAAAGG - Intergenic
1105102355 13:16475129-16475151 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
1105106060 13:16535688-16535710 AATCTGCTCTGTCAATAGAAAGG - Intergenic
1105107055 13:16552058-16552080 AAACTGCTCTGTCAATAGGAAGG - Intergenic
1105108623 13:16577302-16577324 AAACTGCTCTGTCAAAAAGAAGG - Intergenic
1105110433 13:16606628-16606650 AATCTGCTCTGTCAATAGAAAGG - Intergenic
1105114475 13:16673314-16673336 AAACTGCTCTGTCAATAGGAAGG - Intergenic
1105119735 13:16759122-16759144 AAACTGCTCTCTCAATAGAAAGG - Intergenic
1105119941 13:16762535-16762557 AATCTGCTCTGTCAAAAGGAAGG - Intergenic
1105121533 13:16788454-16788476 GAACTGCTCTGTCAAAAGGAAGG - Intergenic
1105126578 13:16870817-16870839 AAACTGCTCTCTCAATAGAAAGG - Intergenic
1105128213 13:16897418-16897440 AATCTGCTCTGTCAAAAGGAAGG - Intergenic
1105129713 13:16921972-16921994 AAACTGCTCTGTCAAAAAGAAGG - Intergenic
1105133884 13:16989854-16989876 AATCTGCTCTGTCAAAAGGAAGG - Intergenic
1105134466 13:16999403-16999425 AAACTGCTCTGTCAAAAAGAAGG - Intergenic
1105135782 13:17021243-17021265 AATCTGCTCTGTCAAAAGGAAGG - Intergenic
1105138210 13:17060799-17060821 AAACTGCTCTGTCAAAAAGAAGG - Intergenic
1105140691 13:17101729-17101751 GAACTGCTCTGTCAAAAGGAAGG - Intergenic
1105142591 13:17132250-17132272 AATCTGCTCTGTCAATAGAAAGG - Intergenic
1105145198 13:17174559-17174581 GAACTGCTCTGTCAATAGAAAGG - Intergenic
1105148969 13:17236455-17236477 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
1105152653 13:17296510-17296532 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
1105152818 13:17299241-17299263 AAACTGCTCTGTCAAAAAGAAGG - Intergenic
1105155985 13:17351117-17351139 AAACTGCTCTGTCAAAAAGAGGG - Intergenic
1105158763 13:17396150-17396172 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
1106995513 13:35475961-35475983 CATCAGCTCTCTCAACGAGATGG - Exonic
1107230435 13:38103838-38103860 GGTCTGGTCTCTCAATAGGTTGG - Intergenic
1107613844 13:42144071-42144093 GCTCTGCTGTTTCAATGAGATGG - Intronic
1108665545 13:52626260-52626282 GAACTGCCATCTCAATAAGTGGG - Intergenic
1108846706 13:54686796-54686818 GTTCTCCTCTCTCAATTAGTTGG - Intergenic
1114001107 14:18247685-18247707 AAACTGCTCTATCAAAAAGAAGG + Intergenic
1116940186 14:50783580-50783602 GTTCTGTTCCCTTAATAAGAGGG + Intronic
1117449737 14:55839330-55839352 GGACTGCCCTCTCAATATGAGGG - Intergenic
1117671585 14:58112436-58112458 TATCTTATCACTCAATAAGAAGG + Intronic
1120176852 14:81303633-81303655 GATCTGCTCACTGAGGAAGAGGG - Intronic
1120683647 14:87511733-87511755 GATCTGCCCTCAAAATAAGCAGG - Intergenic
1122276817 14:100594893-100594915 GATCTGCTGTCACAACAGGAAGG + Intergenic
1125371826 15:38985894-38985916 GTTCTGCTTTCTCAAAAAAATGG + Intergenic
1126333750 15:47564234-47564256 GATTTCTTCTCTCAAGAAGATGG - Intronic
1126903292 15:53336721-53336743 TATCTTATCTTTCAATAAGACGG - Intergenic
1130138392 15:81200774-81200796 GATCTTCTCTTTCAAAAAGATGG + Intronic
1130154273 15:81336239-81336261 GATCTGCTGTCTCAGTTAGTGGG - Intronic
1133486972 16:6229077-6229099 AACATGGTCTCTCAATAAGATGG - Intronic
1133701734 16:8315531-8315553 GAGGTGCTCTTTCTATAAGATGG - Intergenic
1134470661 16:14522498-14522520 GACTTGGTCTCTTAATAAGAGGG + Intronic
1136915680 16:34193698-34193720 GAACTGCTCAATCAATACGAAGG + Intergenic
1136919953 16:34259327-34259349 GATCTGCTCTATCAAGAGAAAGG - Intergenic
1136920039 16:34260690-34260712 GATCTGCTCTATCAAGAGAAAGG - Intergenic
1136920088 16:34261368-34261390 AATCTGCTCTCTCAAAAGAAAGG - Intergenic
1136920734 16:34270212-34270234 GATCTGCTCTATCAAGAGAAAGG - Intergenic
1136921046 16:34275207-34275229 GATCTGCTCTGTGTAAAAGATGG - Intergenic
1136921188 16:34277578-34277600 GATCTGCTCTGTGTAGAAGATGG - Intergenic
1136921556 16:34283679-34283701 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1137082732 16:36083010-36083032 GAACTGCTCTATCAATAGAAAGG - Intergenic
1137095966 16:36257399-36257421 GATCTGCTCTATCAAAAGAAAGG + Intergenic
1137096094 16:36259431-36259453 GATCTGCTCTATCAAAAGAATGG + Intergenic
1137097156 16:36323765-36323787 AATCTGCTCTCTCAAAAGAAAGG - Intergenic
1137098152 16:36337150-36337172 GATCTGCTCTATCAAACAAAAGG + Intergenic
1137100156 16:36370135-36370157 AATCTGCTCTGTCTAAAAGAAGG - Intergenic
1137100275 16:36372177-36372199 GATCTGCTCTGTCTAAAGGAAGG - Intergenic
1137100525 16:36376255-36376277 AATCTGCTCTGTCTAAAAGAAGG - Intergenic
1137100835 16:36381354-36381376 AATCTGCTCTGTCTAAAAGAAGG - Intergenic
1137101036 16:36384749-36384771 AATCTGCTCTGTCTAAAAGAAGG - Intergenic
1137102309 16:36405818-36405840 AATCTGCTCTGTCTAAAAGAAGG - Intergenic
1137103293 16:36422118-36422140 AATCTGCTCTGTCTAAAAGAAGG - Intergenic
1137104309 16:36439108-36439130 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1137108387 16:36506729-36506751 AATCTGCTCTGTCTAAAAGAAGG - Intergenic
1137108795 16:36513524-36513546 AATCTGCTCTGTCTAAAAGAAGG - Intergenic
1137109335 16:36522361-36522383 AATCTGCTCTGTCTAAAAGAAGG - Intergenic
1137109434 16:36524060-36524082 AATCTGCTCTGTCTAAAAGAAGG - Intergenic
1137109694 16:36528470-36528492 AATCTGCTCTGTCTAAAAGAAGG - Intergenic
1137109752 16:36529489-36529511 AATCTGCTCTGTCTATAGGAAGG - Intergenic
1137110213 16:36536958-36536980 AATCTGCTCTGTCTAAAAGAAGG - Intergenic
1137115051 16:36617116-36617138 AATCTGCTCTGTCTAAAAGAAGG - Intergenic
1137116074 16:36634106-36634128 AATCTGCTCTGTCTAAAAGAAGG - Intergenic
1137120116 16:36700794-36700816 AATCTGCTCTGTCTAAAAGAAGG - Intergenic
1137125235 16:36785383-36785405 AATCTGCTCTGTCAAAAGGAAGG - Intergenic
1137127531 16:36823421-36823443 AATCTGCTCTGTCTAAAAGAAGG - Intergenic
1137128672 16:36842454-36842476 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1137128715 16:36843136-36843158 AATCTGCTCTGTCTAAAAGAAGG - Intergenic
1137129123 16:36849923-36849945 AATCTGCTCTGTCTAAAAGAAGG - Intergenic
1137129901 16:36862833-36862855 AATCTGCTCTGTCTAAAAGAAGG - Intergenic
1137130208 16:36867933-36867955 AATCTGCTCTGTCTAAAAGAAGG - Intergenic
1137130959 16:36880494-36880516 AATCTGCTCTGTCTAAAAGAAGG - Intergenic
1137131162 16:36883892-36883914 AATCTGCTCTGTCTAAAAGAAGG - Intergenic
1137134419 16:36938240-36938262 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1137135796 16:36960998-36961020 AATCTGCTCTGTCTAAAAGAAGG - Intergenic
1137137824 16:36994604-36994626 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1137138176 16:37000380-37000402 AATCTGCTCTGTCTAAAAGAAGG - Intergenic
1137140083 16:37031982-37032004 AATCTGCTCTGTCTAAAAGAAGG - Intergenic
1137140809 16:37043870-37043892 AATCTGCTCTGTCTAAAAGAAGG - Intergenic
1137141425 16:37054065-37054087 AATCTGCTCTGTCTAAAAGAAGG - Intergenic
1137141628 16:37057461-37057483 AATCTGCTCTGTCTAAAAGAAGG - Intergenic
1137144169 16:37099595-37099617 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1137144551 16:37106053-37106075 AATCTGCTCTGTCTAAAAGAAGG - Intergenic
1137144904 16:37111832-37111854 AATCTGCTCTGTCTAAAAGAAGG - Intergenic
1137148885 16:37177382-37177404 AATCTGCTCTGTCTAAAAGAAGG - Intergenic
1137149728 16:37191299-37191321 AATCTGCTCTGTCTATAGGAAGG - Intergenic
1137149771 16:37191979-37192001 AATCTGCTCTGTCTAAAAGAAGG - Intergenic
1137151642 16:37222863-37222885 AATCTGCTCTGTCTAAAAGAAGG - Intergenic
1137151801 16:37225576-37225598 AATCTGCTCTGTCTAAAAGAAGG - Intergenic
1137153160 16:37247989-37248011 AATCTGCTCTGTCTAAAAGAAGG - Intergenic
1137154022 16:37262250-37262272 AATCTGCTCTGTCTAAAAGAAGG - Intergenic
1137158133 16:37330206-37330228 AATCTGCTCTGTCTAAAAGAAGG - Intergenic
1137158660 16:37339031-37339053 AATCTGCTCTGTCTAAAAGAAGG - Intergenic
1137158968 16:37344128-37344150 AATCTGCTCTGTCTAAAAGAAGG - Intergenic
1137161587 16:37387599-37387621 AATCTGCTCTGTCTAAAAGAAGG - Intergenic
1137162857 16:37408662-37408684 AATCTGCTCTGTCTAAAAGAAGG - Intergenic
1137164828 16:37441278-37441300 AATCTGCTCTGTCTAAAAGAAGG - Intergenic
1137165255 16:37448410-37448432 AATCTGCTCTGTCTAAAAGAAGG - Intergenic
1137169842 16:37524199-37524221 AATCTGCTCTGTCTAAAAGAAGG - Intergenic
1137170068 16:37527935-37527957 AATCTGCTCTGTCTAAAAGAAGG - Intergenic
1137170561 16:37536091-37536113 AATCTGCTCTGTCTAAAAGAAGG - Intergenic
1137171547 16:37552387-37552409 AATCTGCTCTGTCTAAAAGAAGG - Intergenic
1137173295 16:37581255-37581277 AATCTGCTCTGTCTAAAAGAAGG - Intergenic
1137173872 16:37590767-37590789 AATCTGCTCTGTCTAAAAGAAGG - Intergenic
1137174073 16:37594167-37594189 AATCTGCTCTGTCTAAAAGAAGG - Intergenic
1137174572 16:37602321-37602343 AATCTGCTCTGTCTAAAAGAAGG - Intergenic
1137174886 16:37607410-37607432 AATCTGCTCTGTCTAAAAGAAGG - Intergenic
1137182417 16:37732082-37732104 AATCTGCTCTCTCTAAAAGAAGG - Intergenic
1137185317 16:37779965-37779987 AATCTGCTCTGTCTAAAAGAAGG - Intergenic
1137185477 16:37782684-37782706 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1137185519 16:37783364-37783386 AATCTGCTCTGTCTAAAAGAAGG - Intergenic
1137188574 16:37834315-37834337 AATCTGCTCTGTCTAAAAGAAGG - Intergenic
1137189501 16:37849603-37849625 AATCTGCTCTGTCTAAAAGAAGG - Intergenic
1137190225 16:37861486-37861508 AATCTGCTCTGTCTAAAAGAAGG - Intergenic
1137191649 16:37884926-37884948 AATCTGCTCTGTCTAAAAGAAGG - Intergenic
1137192562 16:37900212-37900234 AATCTGCTCTGTCTAAAAGAAGG - Intergenic
1137193223 16:37911081-37911103 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1137193679 16:37918555-37918577 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1137195271 16:37945057-37945079 AATCTGCTCTGTCTAAAAGAAGG - Intergenic
1137199464 16:38013975-38013997 AATCTGCTCTGTCTAAAAGAAGG - Intergenic
1137201558 16:38048625-38048647 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1137202337 16:38061535-38061557 AATCTGCTCTGTCTAAAAGAAGG - Intergenic
1137202437 16:38063230-38063252 AATCTGCTCTGTCTAAAAGAAGG - Intergenic
1137202903 16:38071041-38071063 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1137204085 16:38090398-38090420 AATCTGCTCTGTCTAAAAGAAGG - Intergenic
1137204706 16:38100593-38100615 AATCTGCTCTGTCTAAAAGAAGG - Intergenic
1137204813 16:38102293-38102315 AATCTGCTCTGTCTAAAAGAAGG - Intergenic
1137205117 16:38107387-38107409 AATCTGCTCTGTCTAAAAGAAGG - Intergenic
1137205411 16:38112138-38112160 AATCTGCTCTGTCTAAAAGAAGG - Intergenic
1137206837 16:38135582-38135604 AATCTGCTCTGTCTAAAAGAAGG - Intergenic
1137207770 16:38150873-38150895 AATCTGCTCTGTCTAAAAGAAGG - Intergenic
1137208919 16:38169901-38169923 AATCTGCTCTGTCTAAAAGAAGG - Intergenic
1137209226 16:38174999-38175021 AATCTGCTCTGTCTAAAAGAAGG - Intergenic
1137210963 16:38203885-38203907 AATCTGCTCTGTCTAAAAGAAGG - Intergenic
1137214787 16:38267168-38267190 AATCTGCTCTCTCTAAAGGAAGG + Intergenic
1140145855 16:72307883-72307905 GATCTGCTCTCTAAAGAAAGTGG + Intergenic
1141447729 16:84072929-84072951 GATTTGCTCCCTGAATCAGAGGG - Intronic
1142593081 17:1015805-1015827 GGAATGCTCTCTCAATGAGATGG + Intronic
1145686007 17:26665017-26665039 AATCTGCTCTATCAAAAGGAAGG - Intergenic
1145687058 17:26680307-26680329 AAACTGCTCTATCAAAAAGAAGG - Intergenic
1146694824 17:34900672-34900694 GATCTTCAATCTCATTAAGAAGG + Intergenic
1148022400 17:44562142-44562164 GATCTGTTCTTTCCAAAAGATGG - Intergenic
1148837756 17:50474924-50474946 GCTCTGCACTCTCAATGACAAGG - Intergenic
1149116463 17:53103041-53103063 GATCTGATCAATCAATAACATGG - Intergenic
1150668917 17:67172190-67172212 CATCTGCTTTCTCAAGCAGATGG - Intronic
1155353194 18:24926490-24926512 AATCTTCTCTATAAATAAGAAGG - Intergenic
1155793366 18:30002109-30002131 AATCTGCTCTCTCAATAACAAGG + Intergenic
1162184144 19:8891626-8891648 GATCTGCTTTCTAAATCTGAGGG - Intronic
1164344931 19:24908427-24908449 AATCTGCTCTGTCTAAAAGAAGG - Intergenic
1164345156 19:27244942-27244964 AATCTGCTCTGTCTAAAAGAAGG - Intergenic
1164345750 19:27254860-27254882 GAACTGCTCTATCAAAAGGAAGG - Intergenic
1164345994 19:27258064-27258086 GAACTGCTCTATCAAAAGGAAGG - Intergenic
1165222983 19:34332469-34332491 TTTCTGCTCTCTGAATAACATGG - Intronic
1165711338 19:38012955-38012977 GACCTGCACTCTCAAGAACAAGG - Intronic
1167718251 19:51158356-51158378 GTTTTGCTCTCTTGATAAGAAGG - Intergenic
1167759887 19:51439356-51439378 GTTCTGCTCTCTTGGTAAGAAGG + Intergenic
1167764645 19:51473495-51473517 GTTCTGCTCTCTTAATAAAAAGG + Intergenic
926254574 2:11179680-11179702 CATTTGCTTTCTCTATAAGATGG - Intergenic
926645131 2:15282720-15282742 AATCTGCTGTCTAAATAAGAAGG + Intronic
929073157 2:38054883-38054905 GCTCTGCTCTCTCAAAAGGACGG + Intronic
931826729 2:66008112-66008134 GATTTTCTCACTCAACAAGAAGG + Intergenic
933437420 2:82265568-82265590 GATATGTTCTCTCAATACGTAGG - Intergenic
934339438 2:92241034-92241056 AAACTGCTCTCTCAAAAAAAAGG - Intergenic
934342252 2:92285603-92285625 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
934344334 2:92318734-92318756 GAACTGCTCTCTCAAAAGAAAGG - Intergenic
934353005 2:92455868-92455890 AAACTGCTCTCTCAAAAAAAAGG - Intergenic
934356649 2:92513458-92513480 AAACTGCTCTCTCAAAAAAAAGG - Intergenic
934357181 2:92521958-92521980 AAACTGCTCTCTCAAAAAAAAGG - Intergenic
934357679 2:92530111-92530133 AAACTGCTCTCTCAAAAAAAAGG - Intergenic
934361740 2:92594529-92594551 AAACTGCTCTCTCAAAAAAAAGG - Intergenic
934362386 2:92604892-92604914 AAACTGCTCTCTCAAAAAAAAGG - Intergenic
934363310 2:92619839-92619861 AAACTGCTCTCTCAAAAAAAAGG - Intergenic
934366059 2:92663668-92663690 AAACTGCTCTCTCAAAAAAAAGG - Intergenic
934376170 2:92825751-92825773 AAACTGCTCTCTCAAAAAAAAGG - Intergenic
934376918 2:92837658-92837680 AAACTGCTCTCTCAAAAAAAAGG - Intergenic
934377253 2:92843087-92843109 AAACTGCTCTCTCAAAAAAAAGG - Intergenic
934380868 2:92900747-92900769 AAACTGCTCTCTCAAAAAAAAGG - Intergenic
934382571 2:92928429-92928451 AAACTGCTCTCTCAAAAAAAAGG - Intergenic
934382812 2:92932343-92932365 AAACTGCTCTCTCAAAAAAAAGG - Intergenic
934383384 2:92941505-92941527 AAACTGCTCTCTCAAAAAAAAGG - Intergenic
934386057 2:92984648-92984670 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
934396402 2:93152210-93152232 AAACTGCTCTCTCAAAAAAAAGG - Intergenic
934399169 2:93196905-93196927 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
934399875 2:93208458-93208480 AAACTGCTCTCTCAAAAAAAAGG - Intergenic
934405221 2:93295039-93295061 AAACTGCTCTCTCAAAAAAAAGG - Intergenic
934408162 2:93341934-93341956 AAACTGCTCTCTCAAAAAAAAGG - Intergenic
934408787 2:93351792-93351814 AAACTGCTCTCTCAAAAAAAAGG - Intergenic
934413390 2:93425520-93425542 AAACTGCTCTCTCAAAAAAAAGG - Intergenic
934413461 2:93426705-93426727 AAACTGCTCTCTCAAAAAAAAGG - Intergenic
934419926 2:93530941-93530963 AAACTGCTCTCTCAAAAAAAAGG - Intergenic
934420085 2:93533323-93533345 AAACTGCTCTCTCAAAAAAAAGG - Intergenic
934425142 2:93614412-93614434 AAACTGCTCTCTCAAAAAAAAGG - Intergenic
934430595 2:93701986-93702008 AATCTGCTCTCTCAAAAGAAAGG - Intergenic
934436362 2:93795348-93795370 AAACTGCTCTCTCAAAAAAAAGG - Intergenic
934437336 2:93811144-93811166 AAACTGCTCTCTCAAAAAAAAGG - Intergenic
934438490 2:93829995-93830017 AAACTGCTCTCTCAAAAAAAAGG - Intergenic
934448539 2:93992322-93992344 AAACTGCTCTCTCAAAAAAAAGG - Intergenic
934449793 2:94012363-94012385 AAACTGCTCTCTCAAAAAAAAGG - Intergenic
934451129 2:94034086-94034108 AAACTGCTCTCTCAAAAAAAAGG - Intergenic
934452914 2:94062775-94062797 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
934454667 2:94140901-94140923 AAACTGCTCTCTCAAAAAAAAGG - Intergenic
944240193 2:197478828-197478850 GATGTGCTCTCTCAAAATGCTGG + Intergenic
944755336 2:202755772-202755794 TTTTTGCTCTCTCAATGAGAAGG - Intronic
945943210 2:215970172-215970194 CAACTGCTTTCCCAATAAGAAGG + Intronic
946017164 2:216613191-216613213 GTCTTGCTTTCTCAATAAGAAGG + Intergenic
1169722447 20:8693394-8693416 GATCTGATTTCTCAATTACATGG - Intronic
1170673335 20:18455176-18455198 GATCTGCTCACTGAGAAAGAAGG + Intronic
1170904785 20:20503548-20503570 GAGCTGCTCTTTCACTAAGCAGG + Intronic
1171181044 20:23090579-23090601 AATCTGCTCTCTAAATAAAATGG - Intergenic
1171573904 20:26280491-26280513 AAACTGCTCTATCAAAAAGAAGG - Intergenic
1171575931 20:26317109-26317131 GAACTGCTCTCTCAAAAGAAGGG - Intergenic
1171576065 20:26319841-26319863 GAACTGCTCTCTCAAAAGAAGGG - Intergenic
1171691582 20:28109862-28109884 AAACTGCTCTCTCAAAAAAAAGG - Intergenic
1171836397 20:30155141-30155163 AAACTGCTCTATCAAAAAGAAGG + Intergenic
1176763041 21:12979077-12979099 AAACTGCTCTATCAAAAAGAAGG + Intergenic
1177095331 21:16825072-16825094 AATCTGCTCTATCAACAATATGG - Intergenic
1177859082 21:26431496-26431518 GATTTGCTATCTAAATAAGATGG - Intergenic
1179779359 21:43689552-43689574 GCGCTGCTCCCTCACTAAGAGGG + Intronic
1180425619 22:15178483-15178505 AAACTGCTCTATCAAAAAGAAGG + Intergenic
1180505909 22:16002954-16002976 AAACTGCTCTCTCAAAAAGAAGG + Intergenic
1180526970 22:16276655-16276677 AAACTGCTCTATCAAAAAGAAGG - Intergenic
1203332748 22_KI270739v1_random:19093-19115 AAACTGCTCTCTCAAAAAGAAGG - Intergenic
1202717476 2_KI270715v1_random:24568-24590 GAACTGCTCTCTCAAAAGAAAGG - Intergenic
1202719249 2_KI270715v1_random:52417-52439 AAACTGCTCTCTCAAAAAAAAGG - Intergenic
1202719358 2_KI270715v1_random:54115-54137 AAACTGCTCTCTCAAAAAAAAGG - Intergenic
1202719509 2_KI270715v1_random:56493-56515 AAACTGCTCTCTCAAAAAAAAGG - Intergenic
1202719661 2_KI270715v1_random:58871-58893 AAACTGCTCTCTCAAAAAAAAGG - Intergenic
1202719872 2_KI270715v1_random:62271-62293 AAACTGCTCTCTCAAAAAAAAGG - Intergenic
1202719955 2_KI270715v1_random:63631-63653 AAACTGCTCTCTCAAAAAAAAGG - Intergenic
1202720082 2_KI270715v1_random:65671-65693 AAACTGCTCTCTCAAAAAAAAGG - Intergenic
1202720235 2_KI270715v1_random:68049-68071 AAACTGCTCTCTCAAAAAAAAGG - Intergenic
1202720386 2_KI270715v1_random:70426-70448 AAACTGCTCTCTCAAAAAAAAGG - Intergenic
1202725457 2_KI270715v1_random:150980-151002 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
1202733016 2_KI270716v1_random:104066-104088 AATCTGCTCTCTCAAAAGAAAGG - Intergenic
950169990 3:10832255-10832277 GATCTCTTCTCTCAAGGAGAGGG + Intronic
953478909 3:43232340-43232362 AATCTTATCGCTCAATAAGAGGG + Intergenic
958206688 3:90407343-90407365 AATCTGCTCTCTTAAAAAGTAGG + Intergenic
958208936 3:90442710-90442732 AAGCTGCTCTATCAAAAAGAAGG + Intergenic
958209054 3:90444755-90444777 AAACTGCTCTATCAAAAAGAAGG + Intergenic
958211491 3:90484951-90484973 AATCTGCTCTATCAAAAGGAAGG + Intergenic
958211724 3:90489543-90489565 AAACTGCTCTCTCAAAAGGAAGG + Intergenic
958211844 3:90491875-90491897 AATCTGCTCTATCAAAAGGAAGG + Intergenic
958212138 3:90497995-90498017 AATCTGCTCTATCAAAAGGAAGG + Intergenic
958212153 3:90498334-90498356 GAACTGCTCTATCAAAAGGAAGG + Intergenic
958212228 3:90500036-90500058 AATCTGCTCTATCAAAAGGAAGG + Intergenic
958215046 3:90555468-90555490 AATCTGCTCTATCAAAAGGAAGG + Intergenic
958217109 3:90599843-90599865 AATCTGCTCTATCAAAATGAAGG + Intergenic
958220255 3:90662572-90662594 AAACTGCTCTATCAAAAAGAAGG + Intergenic
958226319 3:90826369-90826391 AAACTGCTCTATCAAAAAGAAGG - Intergenic
958273475 3:91540596-91540618 AATCTGCTCTCTCTAAAGGAAGG + Intergenic
958298785 3:91955182-91955204 AATCTGCTCTGTCTAAAAGAAGG - Intergenic
958403337 3:93718135-93718157 GAACTGCTCTGTCAAAAGGAAGG + Intergenic
958403497 3:93721544-93721566 AATCTGCTCTATCAAAAAGAAGG + Intergenic
958404815 3:93742262-93742284 AATCTGCTCTATCAAAAGGAAGG + Intergenic
958405688 3:93755984-93756006 GAACTGCTCTATCAAAAGGAAGG + Intergenic
961598972 3:128043936-128043958 GATGTGCTGTTTCCATAAGAAGG - Intergenic
970201860 4:13617669-13617691 GATCTGCTGACTCAGTAGGAGGG - Intronic
971047523 4:22821889-22821911 ACTCTGCTCTCTCAGTAATAAGG - Intergenic
971144242 4:23959762-23959784 GTTCTGCTCTATAAATGAGAAGG - Intergenic
973405243 4:49724867-49724889 AAACTGCTCTCTCAAAAAGATGG - Intergenic
973436841 4:50246709-50246731 AATCTGCTCTGTCAAAAGGATGG - Intergenic
974350570 4:60739416-60739438 GATCTCCTCTCTCAATTTTATGG - Intergenic
974751415 4:66146065-66146087 GCTCTCCTCTCTCAATCAGTTGG - Intergenic
976547468 4:86353566-86353588 GATCTGCTTTCTCAATATAATGG + Intronic
978360156 4:107923192-107923214 GATCTTTACTCTCAGTAAGATGG - Intergenic
981688236 4:147479357-147479379 GATCAGCTGTCTCAATAGGTGGG + Intergenic
989044612 5:37262414-37262436 AATCTGCTCTCTATATAAGGAGG + Intergenic
989858811 5:46338413-46338435 AAACTGCTCTATCAAAAAGAGGG + Intergenic
989859861 5:46357306-46357328 AAACTGCTCTATCAATCAGAAGG + Intergenic
989861271 5:46379174-46379196 GAACTGCTCTATCAAAAGGAAGG - Intergenic
989864648 5:46434977-46434999 AAACTGCTCTCTCAAAAGGAAGG + Intergenic
989864794 5:46487661-46487683 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989865122 5:46493301-46493323 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989865275 5:46496035-46496057 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989865324 5:46496891-46496913 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989865481 5:46499624-46499646 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989865818 5:46505263-46505285 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989865872 5:46506113-46506135 AAACTGCTCTCTCAAAAAGAAGG - Intergenic
989865923 5:46507138-46507160 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989865974 5:46507995-46508017 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989866082 5:46509872-46509894 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989866098 5:46510042-46510064 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989866132 5:46510731-46510753 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989866238 5:46512607-46512629 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989866285 5:46513465-46513487 AAACTGCTCTCTCAAGAGGAAGG - Intergenic
989866436 5:46516194-46516216 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989866593 5:46518929-46518951 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989866695 5:46520805-46520827 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989866743 5:46521663-46521685 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989866854 5:46523538-46523560 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989866901 5:46524396-46524418 TAACTGCTCTCTCAAAAGGAAGG - Intergenic
989867089 5:46527351-46527373 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989867251 5:46530080-46530102 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989867332 5:46531448-46531470 AAACTGCTCTCTCAACAGGAAGG - Intergenic
989867437 5:46533324-46533346 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989867487 5:46534182-46534204 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989867596 5:46536058-46536080 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989867645 5:46536910-46536932 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989867754 5:46538786-46538808 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989867804 5:46539639-46539661 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989867894 5:46541344-46541366 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989868065 5:46544414-46544436 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989868235 5:46547437-46547459 TAACTGCTCTCTCAAAAGGAAGG - Intergenic
989868267 5:46548121-46548143 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989868314 5:46548972-46548994 AAACTGCTCTCTCAAAAAGAAGG - Intergenic
989868410 5:46550677-46550699 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989868514 5:46552553-46552575 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989868613 5:46553934-46553956 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989868666 5:46554784-46554806 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989868709 5:46555637-46555659 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989868760 5:46556495-46556517 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989868906 5:46559230-46559252 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989869011 5:46561106-46561128 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989869060 5:46561959-46561981 AAACTGCTCTCTCAACAGGAAGG - Intergenic
989869203 5:46564329-46564351 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989869254 5:46565188-46565210 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989869309 5:46566037-46566059 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989869410 5:46567920-46567942 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989869483 5:46569215-46569237 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989869616 5:46571773-46571795 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989869752 5:46574331-46574353 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989869885 5:46576889-46576911 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989870022 5:46579448-46579470 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989870157 5:46582007-46582029 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989870294 5:46584565-46584587 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989870430 5:46587123-46587145 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989870789 5:46593776-46593798 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989870851 5:46594802-46594824 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989870925 5:46596337-46596359 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989870975 5:46597191-46597213 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989871113 5:46599749-46599771 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989871389 5:46604866-46604888 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989871664 5:46609983-46610005 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989871788 5:46612200-46612222 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989871926 5:46614761-46614783 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989872208 5:46619877-46619899 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989872345 5:46622438-46622460 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989872620 5:46627551-46627573 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989872965 5:46633860-46633882 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989873107 5:46636421-46636443 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989873244 5:46638979-46639001 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989873279 5:46639490-46639512 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989873516 5:46644099-46644121 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989873658 5:46646657-46646679 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989873784 5:46649046-46649068 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989873932 5:46651604-46651626 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989874068 5:46654162-46654184 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989874203 5:46656720-46656742 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989874313 5:46658938-46658960 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989874341 5:46659279-46659301 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989874613 5:46664392-46664414 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989874882 5:46669510-46669532 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989875019 5:46672068-46672090 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989875158 5:46674625-46674647 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989875295 5:46677183-46677205 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989875568 5:46682303-46682325 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989875705 5:46684863-46684885 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989875847 5:46687421-46687443 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989875952 5:46689467-46689489 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989876157 5:46693567-46693589 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989876181 5:46693910-46693932 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989876298 5:46696127-46696149 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989876321 5:46696469-46696491 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989876397 5:46698003-46698025 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989876453 5:46699027-46699049 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989876592 5:46701585-46701607 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989876724 5:46704142-46704164 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989876856 5:46706702-46706724 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989876984 5:46709261-46709283 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989877127 5:46711822-46711844 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989877261 5:46714380-46714402 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989877542 5:46719494-46719516 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989877680 5:46722055-46722077 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989877815 5:46724613-46724635 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989877958 5:46727174-46727196 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989878093 5:46729732-46729754 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989878195 5:46731778-46731800 TAACTGCTCTCTCAAAAGGAAGG - Intergenic
989878295 5:46733656-46733678 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989878433 5:46736214-46736236 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989878568 5:46738774-46738796 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989878694 5:46741161-46741183 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989878833 5:46743719-46743741 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989878974 5:46746280-46746302 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989879116 5:46748838-46748860 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989879231 5:46751054-46751076 ACACTGCTCTCTCAAAAAGAAGG - Intergenic
989879255 5:46751395-46751417 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989879388 5:46753956-46753978 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989879505 5:46756179-46756201 ACACTGCTCTCTCAAAAAGAAGG - Intergenic
989879527 5:46756520-46756542 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989879669 5:46759080-46759102 CAACTGCTCTCTCAAAAGGAAGG - Intergenic
989879801 5:46761469-46761491 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989879939 5:46764028-46764050 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989880077 5:46766587-46766609 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989880121 5:46767437-46767459 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989880152 5:46768122-46768144 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989880309 5:46771191-46771213 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989880345 5:46771703-46771725 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989880486 5:46774261-46774283 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989880621 5:46776818-46776840 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989880762 5:46779377-46779399 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989880814 5:46780399-46780421 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989880895 5:46781935-46781957 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989881032 5:46784494-46784516 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989881166 5:46787058-46787080 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989881274 5:46789105-46789127 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989881306 5:46789617-46789639 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989881444 5:46792174-46792196 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989881584 5:46794732-46794754 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989881726 5:46797559-46797581 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989881737 5:46797730-46797752 GAACTGCTCTATCAAAAGGACGG - Intergenic
989881784 5:46798924-46798946 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989881911 5:46801481-46801503 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989882073 5:46804546-46804568 GAACTGCTCTATCAAAAGGACGG - Intergenic
989882127 5:46805739-46805761 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989882255 5:46808295-46808317 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989882402 5:46811188-46811210 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989882414 5:46811359-46811381 GAACTGCTCTATCAAAAGGACGG - Intergenic
989882629 5:46815622-46815644 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989882641 5:46815793-46815815 GAACTGCTCTATCAAAAGGACGG - Intergenic
989882698 5:46816987-46817009 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989882911 5:46821077-46821099 GAACTGCTCTATCAAAAGGACGG - Intergenic
989882965 5:46822270-46822292 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989883114 5:46825165-46825187 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989883126 5:46825336-46825358 GAACTGCTCTATCAAAAGGACGG - Intergenic
989883185 5:46826529-46826551 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989883405 5:46830792-46830814 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989883417 5:46830963-46830985 GAACTGCTCTATCAAAAGGACGG - Intergenic
989883478 5:46832158-46832180 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989883707 5:46836763-46836785 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989883719 5:46836934-46836956 GAACTGCTCTATCAAAAGGACGG - Intergenic
989883778 5:46838128-46838150 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989883974 5:46842048-46842070 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989883986 5:46842219-46842241 GAACTGCTCTATCAAAAGGACGG - Intergenic
989884045 5:46843413-46843435 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989884236 5:46847332-46847354 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989884247 5:46847501-46847523 GAACTGCTCTATCAAAAGGACGG - Intergenic
989884304 5:46848694-46848716 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989884511 5:46852784-46852806 GAACTGCTCTATCAAAAGGACGG - Intergenic
989884570 5:46853978-46854000 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989884777 5:46858068-46858090 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989884789 5:46858239-46858261 GAACTGCTCTATCAAAAGGACGG - Intergenic
989884850 5:46859433-46859455 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989885039 5:46863181-46863203 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989885051 5:46863352-46863374 GAACTGCTCTATCAAAAGGACGG - Intergenic
989885111 5:46864545-46864567 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989885251 5:46867270-46867292 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989885263 5:46867441-46867463 GAACTGCTCTATCAAAAGGACGG - Intergenic
989885322 5:46868635-46868657 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989885540 5:46872896-46872918 GAACTGCTCTATCAAAAGGACGG - Intergenic
989885599 5:46874090-46874112 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989885809 5:46878179-46878201 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989885821 5:46878350-46878372 GAACTGCTCTATCAAAAGGACGG - Intergenic
989885880 5:46879544-46879566 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989886086 5:46883635-46883657 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989886098 5:46883806-46883828 GAACTGCTCTATCAAAAGGACGG - Intergenic
989886157 5:46885000-46885022 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989886368 5:46889090-46889112 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989886380 5:46889261-46889283 GAACTGCTCTATCAAAAGGACGG - Intergenic
989886439 5:46890456-46890478 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989886592 5:46893521-46893543 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989886604 5:46893692-46893714 GAACTGCTCTATCAAAAGGACGG - Intergenic
989886663 5:46894886-46894908 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989886804 5:46897609-46897631 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989886816 5:46897780-46897802 GAACTGCTCTATCAAAAGGACGG - Intergenic
989886877 5:46898974-46898996 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989887052 5:46902383-46902405 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989887064 5:46902554-46902576 GAACTGCTCTATCAAAAGGACGG - Intergenic
989887123 5:46903748-46903770 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989887333 5:46907838-46907860 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989887345 5:46908009-46908031 GAACTGCTCTATCAAAAGGACGG - Intergenic
989887407 5:46909204-46909226 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989887672 5:46914488-46914510 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989887882 5:46918578-46918600 GAACTGCTCTATCAAAAGGACGG - Intergenic
989887936 5:46919771-46919793 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989888062 5:46922326-46922348 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989888279 5:46926590-46926612 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989888478 5:46930511-46930533 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989888490 5:46930682-46930704 GAACTGCTCTATCAAAAGGACGG - Intergenic
989888549 5:46931876-46931898 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989888772 5:46936137-46936159 GAACTGCTCTATCAAAAGGACGG - Intergenic
989888826 5:46937330-46937352 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989888977 5:46940224-46940246 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989888989 5:46940395-46940417 GAACTGCTCTATCAAAAGGACGG - Intergenic
989889048 5:46941589-46941611 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989889256 5:46945679-46945701 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989889268 5:46945850-46945872 GAACTGCTCTATCAAAAGGACGG - Intergenic
989889326 5:46947044-46947066 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989889518 5:46950965-46950987 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989889797 5:46956417-46956439 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989889809 5:46956588-46956610 GAACTGCTCTATCAAAAGGACGG - Intergenic
989889873 5:46957782-46957804 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989889881 5:46957953-46957975 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989889961 5:46959659-46959681 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989890156 5:46963583-46963605 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989890281 5:46966137-46966159 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989890491 5:46970227-46970249 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989890503 5:46970398-46970420 GAACTGCTCTATCAAAAGGACGG - Intergenic
989890562 5:46971592-46971614 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989890704 5:46974317-46974339 AAACTGCTCTCTCAAAAAGAAGG - Intergenic
989890769 5:46975683-46975705 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989890978 5:46979774-46979796 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989890990 5:46979945-46979967 GAACTGCTCTATCAAAAGGACGG - Intergenic
989891049 5:46981139-46981161 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989891182 5:46983863-46983885 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989891332 5:46986759-46986781 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989891343 5:46986929-46986951 GAACTGCTCTATCAAAAGGACGG - Intergenic
989891397 5:46988122-46988144 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989891576 5:46991531-46991553 GAACTGCTCTATCAAAAGGACGG - Intergenic
989891640 5:46992725-46992747 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989891900 5:46997838-46997860 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989891912 5:46998009-46998031 GAACTGCTCTATCAAAAGGACGG - Intergenic
989891971 5:46999204-46999226 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989892176 5:47003294-47003316 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989892188 5:47003465-47003487 GAACTGCTCTATCAAAAGGACGG - Intergenic
989892250 5:47004659-47004681 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989892416 5:47007895-47007917 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989892428 5:47008066-47008088 GAACTGCTCTATCAAAAGGACGG - Intergenic
989892489 5:47009261-47009283 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989892700 5:47013350-47013372 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989892712 5:47013521-47013543 GAACTGCTCTATCAAAAGGACGG - Intergenic
989892771 5:47014715-47014737 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989892895 5:47017271-47017293 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989893097 5:47021360-47021382 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989893109 5:47021531-47021553 GAACTGCTCTATCAAAAGGACGG - Intergenic
989893168 5:47022726-47022748 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989893377 5:47026817-47026839 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989893389 5:47026988-47027010 GAACTGCTCTATCAAAAGGACGG - Intergenic
989893522 5:47029543-47029565 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989893534 5:47029714-47029736 GAACTGCTCTATCAAAAGGACGG - Intergenic
989893591 5:47030908-47030930 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989893808 5:47034750-47034772 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989893820 5:47034921-47034943 GAACTGCTCTATCAAAAGGACGG - Intergenic
989893879 5:47036114-47036136 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989894032 5:47039013-47039035 GAACTGCTCTATCAAAAGGACGG - Intergenic
989894090 5:47040207-47040229 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989894253 5:47043274-47043296 GAACTGCTCTATCAAAAGGACGG - Intergenic
989894311 5:47044467-47044489 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989894518 5:47048556-47048578 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989894530 5:47048727-47048749 GAACTGCTCTATCAAAAGGACGG - Intergenic
989894592 5:47049921-47049943 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989894789 5:47053840-47053862 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989894844 5:47054864-47054886 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989895003 5:47057760-47057782 GAACTGCTCTATCAAAAGGACGG - Intergenic
989895045 5:47058612-47058634 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989895233 5:47062375-47062397 AAACTGCTCTCTCAAAAGGAAGG + Intergenic
989895416 5:47065956-47065978 AAACTGCTCTCTCAAAAGGAAGG + Intergenic
989895820 5:47078400-47078422 GAACTGCTCTATCAAAAGGACGG + Intergenic
989895831 5:47078570-47078592 AAACTGCTCTCTCAAAAGGAAGG + Intergenic
989895920 5:47082668-47082690 TAACTGCTCTCTCAAAAGGAAGG + Intergenic
989896161 5:47087448-47087470 AATCTGCTCTATCAAAAGGAAGG + Intergenic
989896754 5:47098879-47098901 AAACTGCTCTCTCAAAAGGAGGG + Intergenic
989897221 5:47106007-47106029 GTACTGCTCTATCAATAGGACGG + Intergenic
989897287 5:47107388-47107410 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989897446 5:47110284-47110306 GAACTGCTCTATCAAAAGGACGG - Intergenic
989897505 5:47111477-47111499 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989897668 5:47114372-47114394 GAACTGCTCTATCAAAAGGACGG - Intergenic
989897729 5:47115565-47115587 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989897890 5:47118463-47118485 GAACTGCTCTATCAAAAGGACGG - Intergenic
989898013 5:47120849-47120871 GAACTGCTCTATCAAAAGGACGG - Intergenic
989898192 5:47124086-47124108 GAACTGCTCTATCAAAAGGACGG - Intergenic
989898249 5:47125279-47125301 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989898413 5:47128176-47128198 GAACTGCTCTATCAAAAGGACGG - Intergenic
989898472 5:47129369-47129391 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989898631 5:47132265-47132287 GAACTGCTCTATCAAAAGGACGG - Intergenic
989898689 5:47133458-47133480 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989898847 5:47136353-47136375 GAACTGCTCTATCAAAAGGACGG - Intergenic
989898906 5:47137546-47137568 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989899070 5:47140443-47140465 GAACTGCTCTATCAAAAGGACGG - Intergenic
989899134 5:47141636-47141658 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989899286 5:47144360-47144382 GAACTGCTCTATCAAAAGGACGG - Intergenic
989899349 5:47145553-47145575 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989899508 5:47148449-47148471 GAACTGCTCTATCAAAAGGACGG - Intergenic
989899569 5:47149642-47149664 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
989899733 5:47152540-47152562 GAACTGCTCTATCAAAAGGACGG - Intergenic
989899841 5:47154680-47154702 AATCTGCTCTATCTAAAAGAAGG - Intergenic
989899867 5:47155020-47155042 AATCTGCTCTATCTAAAAGAAGG - Intergenic
989899897 5:47155361-47155383 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
989900010 5:47157400-47157422 AATCTGCTCTATCTAAAAGAAGG - Intergenic
989900034 5:47157740-47157762 AATCTGCTCTATCTAAAAGAAGG - Intergenic
989900065 5:47158081-47158103 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
989900169 5:47160121-47160143 AATCTGCTCTATCTAAAAGAAGG - Intergenic
989900193 5:47160461-47160483 AATCTGCTCTATCTAAAAGAAGG - Intergenic
989900224 5:47160802-47160824 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
989900331 5:47162842-47162864 AATCTGCTCTATCTAAAAGAAGG - Intergenic
989900355 5:47163182-47163204 AATCTGCTCTATCTAAAAGAAGG - Intergenic
989900384 5:47163523-47163545 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
989900494 5:47165563-47165585 AATCTACTCTCTCTAAAAGAAGG - Intergenic
989900516 5:47165902-47165924 AATCTGCTCTATCTAAAAGAAGG - Intergenic
989900542 5:47166243-47166265 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
989900653 5:47168281-47168303 AATCTGCTCTATCTAAAAGAAGG - Intergenic
989900677 5:47168621-47168643 AATCTGCTCTATCTAAAAGAAGG - Intergenic
989900708 5:47168962-47168984 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
989900822 5:47171001-47171023 AATCTGCTCTATCTAAAAGAAGG - Intergenic
989900846 5:47171342-47171364 AATCTGCTCTATCTAAAAGAAGG - Intergenic
989900877 5:47171683-47171705 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
989900984 5:47173722-47173744 AATCTGCTCTATCTAAAAGAAGG - Intergenic
989901009 5:47174063-47174085 AATCTGCTCTATCTAAAAGAAGG - Intergenic
989901040 5:47174404-47174426 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
989901152 5:47176443-47176465 AATCTGCTCTATCTAAAAGAAGG - Intergenic
989901176 5:47176784-47176806 AATCTGCTCTATCTAAAAGAAGG - Intergenic
989901207 5:47177125-47177147 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
989901316 5:47179164-47179186 AATCTGCTCTATCTAAAAGAAGG - Intergenic
989901340 5:47179504-47179526 AATCTGCTCTATCTAAAAGAAGG - Intergenic
989901462 5:47181545-47181567 AATCTGCTCTATCTAAAAGAAGG - Intergenic
989901485 5:47181885-47181907 AATCTGCTCTATCTAAAAGAAGG - Intergenic
989901628 5:47184265-47184287 AATCTGCTCTATCTAAAAGAAGG - Intergenic
989901651 5:47184605-47184627 AATCTGCTCTATCTAAAAGAAGG - Intergenic
989901682 5:47184946-47184968 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
989901793 5:47186985-47187007 AATCTGCTCTATCTAAAAGAAGG - Intergenic
989901817 5:47187325-47187347 AATCTGCTCTATCTAAAAGAAGG - Intergenic
989901848 5:47187666-47187688 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
989901958 5:47189707-47189729 AATCTGCTCTATCTAAAAGAAGG - Intergenic
989901982 5:47190049-47190071 AATCTGCTCTATCTAAAAGAAGG - Intergenic
989902013 5:47190390-47190412 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
989902122 5:47192427-47192449 AATCTGCTCTATCTAAAAGAAGG - Intergenic
989902146 5:47192767-47192789 AATCTGCTCTATCTAAAAGAAGG - Intergenic
989902176 5:47193108-47193130 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
989902284 5:47195146-47195168 AATCTGCTCTATCTAAAAGAAGG - Intergenic
989902308 5:47195486-47195508 AATCTGCTCTATCTAAAAGAAGG - Intergenic
989902339 5:47195827-47195849 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
989902434 5:47197526-47197548 AATCTGCTCTATCTAAAAGAAGG - Intergenic
989902459 5:47197866-47197888 AATCTGCTCTATCTAAAAGAAGG - Intergenic
989902490 5:47198207-47198229 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
989902602 5:47200246-47200268 AATCTGCTCTATCTAAAAGAAGG - Intergenic
989902626 5:47200586-47200608 AATCTGCTCTATCTAAAAGAAGG - Intergenic
989902657 5:47200927-47200949 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
989902765 5:47202965-47202987 AATCTGCTCTATCTAAAAGAAGG - Intergenic
989902791 5:47203306-47203328 AATCTGCTCTATCTAAAAGAAGG - Intergenic
989902822 5:47203647-47203669 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
989902935 5:47205684-47205706 AATCTGCTCTATCTAAAAGAAGG - Intergenic
989902959 5:47206024-47206046 AATCTGCTCTATCTAAAAGAAGG - Intergenic
989902990 5:47206365-47206387 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
989903100 5:47208405-47208427 AATCTGCTCTATCTAAAAGAAGG - Intergenic
989903123 5:47208745-47208767 AATCTGCTCTATCTAAAAGAAGG - Intergenic
989903322 5:47212141-47212163 AATCTGCTCTATCTAAAAGAAGG - Intergenic
989903345 5:47212481-47212503 AATCTGCTCTATCTAAAAGAAGG - Intergenic
989903465 5:47214521-47214543 AATCTGCTCTATCTAAAAGAAGG - Intergenic
989903489 5:47214861-47214883 AATCTGCTCTATCTAAAAGAAGG - Intergenic
989903662 5:47217922-47217944 AATCTGCTCTATCTAAAAGAAGG - Intergenic
989903686 5:47218263-47218285 AATCTGCTCTATCTAAAAGAAGG - Intergenic
989903717 5:47218604-47218626 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
989903825 5:47220642-47220664 AATCTGCTCTATCTAAAAGAAGG - Intergenic
989903849 5:47220982-47221004 AATCTGCTCTATCTAAAAGAAGG - Intergenic
989903880 5:47221323-47221345 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
989903973 5:47223021-47223043 AATCTGCTCTATCTAAAAGAAGG - Intergenic
989903997 5:47223362-47223384 AATCTGCTCTATCTAAAAGAAGG - Intergenic
989904140 5:47225742-47225764 AATCTGCTCTATCTAAAAGAAGG - Intergenic
989904166 5:47226082-47226104 AATCTGCTCTATCTAAAAGAAGG - Intergenic
989904197 5:47226423-47226445 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
989904318 5:47228629-47228651 AATCTGCTCTATCTAAAAGAAGG - Intergenic
989904343 5:47228969-47228991 AATCTGCTCTATCTAAAAGAAGG - Intergenic
989904484 5:47231349-47231371 AATCTGCTCTATCTAAAAGAAGG - Intergenic
989904507 5:47231689-47231711 AATCTGCTCTATCTAAAAGAAGG - Intergenic
989904537 5:47232030-47232052 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
989904628 5:47233730-47233752 AATCTGCTCTGTCTAAAAGAAGG - Intergenic
989904645 5:47234070-47234092 AATCTGCTCTATCTAAAAGAAGG - Intergenic
989904669 5:47234410-47234432 AATCTGCTCTATCTAAAAGAAGG - Intergenic
989904809 5:47236789-47236811 AATCTGCTCTATCTAAAAGAAGG - Intergenic
989904833 5:47237129-47237151 AATCTGCTCTATCTAAAAGAAGG - Intergenic
989904864 5:47237470-47237492 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
989904978 5:47239508-47239530 AATCTGCTCTATCTAAAAGAAGG - Intergenic
989905056 5:47240868-47240890 AATCTGCTCTATCTAAAAGAAGG - Intergenic
989905079 5:47241208-47241230 AATCTGCTCTATCTAAAAGAAGG - Intergenic
989905110 5:47241549-47241571 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
989905145 5:47242228-47242250 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
989905220 5:47243587-47243609 AATCTGCTCTATCTAAAAGAAGG - Intergenic
989905246 5:47243927-47243949 AATCTGCTCTATCTAAAAGAAGG - Intergenic
989905277 5:47244268-47244290 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
989905390 5:47246303-47246325 AATCTGCTCTATCTAAAAGAAGG - Intergenic
989905416 5:47246643-47246665 AATCTGCTCTATCTAAAAGAAGG - Intergenic
989905447 5:47246984-47247006 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
989905540 5:47248683-47248705 TATCTGCTCTATCTAAAAGAAGG - Intergenic
989905566 5:47249023-47249045 AATCTGCTCTATCTAAAAGAAGG - Intergenic
989905597 5:47249364-47249386 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
989905707 5:47251403-47251425 AATCTGCTCTATCTAAAAGAAGG - Intergenic
989905731 5:47251743-47251765 AATCTGCTCTATCTAAAAGAAGG - Intergenic
989905875 5:47254122-47254144 AATCTGCTCTATCTAAAAGAAGG - Intergenic
989905899 5:47254462-47254484 AATCTGCTCTATCTAAAAGAAGG - Intergenic
989905930 5:47254803-47254825 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
989905950 5:47255144-47255166 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
989906043 5:47256844-47256866 AATCTGCTCTATCTAAAAGAAGG - Intergenic
989906067 5:47257184-47257206 AATCTGCTCTATCTAAAAGAAGG - Intergenic
989906098 5:47257525-47257547 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
989906206 5:47259564-47259586 AATCTGCTCTATCTAAAAGAAGG - Intergenic
989906230 5:47259904-47259926 AATCTGCTCTATCTAAAAGAAGG - Intergenic
989906261 5:47260245-47260267 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
989906398 5:47262624-47262646 AATCTGCTCTATCTAAAAGAAGG - Intergenic
989906429 5:47262965-47262987 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
989906520 5:47264665-47264687 AATCTGCTCTGTCTAAAAGAAGG - Intergenic
989906536 5:47265005-47265027 AATCTGCTCTATCTAAAAGAAGG - Intergenic
989906561 5:47265345-47265367 AATCTGCTCTATCTAAAAGAAGG - Intergenic
989906594 5:47265686-47265708 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
989906701 5:47267727-47267749 AATCTGCTCTATCTAAAAGAAGG - Intergenic
989906725 5:47268067-47268089 AATCTGCTCTATCTAAAAGAAGG - Intergenic
989906776 5:47268749-47268771 AATCTGCTCTCTCGAAAGGAAGG - Intergenic
989906873 5:47270449-47270471 AATCTGCTCTATCTAAAAGAAGG - Intergenic
989906897 5:47270789-47270811 AATCTGCTCTATCTAAAAGAAGG - Intergenic
989906928 5:47271130-47271152 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
989907020 5:47272830-47272852 AATCTGCTCTGTCTAAAAGAAGG - Intergenic
989907037 5:47273170-47273192 AATCTGCTCTATCTAAAAGAAGG - Intergenic
989907063 5:47273510-47273532 AATCTGCTCTATCTAAAAGAAGG - Intergenic
989907094 5:47273851-47273873 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
989907200 5:47275889-47275911 TATCTGCTCTATCTAAAAGAAGG - Intergenic
989907224 5:47276230-47276252 AATCTGCTCTATCTAAAAGAAGG - Intergenic
989907255 5:47276571-47276593 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
989907366 5:47278611-47278633 AATCTGCTCTATCTAAAAGAAGG - Intergenic
989907390 5:47278951-47278973 AATCTGCTCTATCTAAAAGAAGG - Intergenic
989907421 5:47279292-47279314 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
989907529 5:47281331-47281353 AATCTGCTCTATCTAAAAGAAGG - Intergenic
989907551 5:47281670-47281692 AATCTGCTCTATCTAAAAGAAGG - Intergenic
989907582 5:47282011-47282033 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
989907691 5:47284049-47284071 AATCTGCTCTATCTAAAAGAAGG - Intergenic
989907717 5:47284389-47284411 AATCTGCTCTATCTAAAAGAAGG - Intergenic
989907748 5:47284730-47284752 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
989907858 5:47286770-47286792 AATCTGCTCTATCTAAAAGAAGG - Intergenic
989907882 5:47287110-47287132 AATCTGCTCTATCTAAAAGAAGG - Intergenic
989908043 5:47289828-47289850 AATCTGCTCTATCTAAAAGAAGG - Intergenic
989908070 5:47290169-47290191 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
989908180 5:47292209-47292231 AATCTGCTCTATCTAAAAGAAGG - Intergenic
989908205 5:47292549-47292571 AATCTGCTCTATCTAAAAGAAGG - Intergenic
989908344 5:47294929-47294951 AATCTGCTCTATCTAAAAGAAGG - Intergenic
989908369 5:47295269-47295291 AATCTGCTCTATCTAAAAGAAGG - Intergenic
989908401 5:47295611-47295633 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
990118461 5:52419086-52419108 GATTTGCTCTAACACTAAGAAGG - Intergenic
990902561 5:60768811-60768833 GATCTTCTCTCTCAGTATAATGG + Intronic
993993682 5:94692163-94692185 GATCTGCTCACTCAAGTGGACGG + Exonic
996778715 5:127160374-127160396 GCTCTGATCTCTCACTGAGATGG - Intergenic
998060653 5:139116207-139116229 GATCTGCACGAGCAATAAGAGGG - Intronic
998888714 5:146723138-146723160 CATATGCTCTCTCAATGAGGAGG - Intronic
1202771358 5_GL000208v1_random:1421-1443 AATCTTCTCTCTCAAAAGGAAGG + Intergenic
1202771381 5_GL000208v1_random:1932-1954 AAACTGCTCTCTCAAAAGGAAGG + Intergenic
1202771444 5_GL000208v1_random:3292-3314 TAACTGCTCTCTCAAAAGGAAGG + Intergenic
1202771687 5_GL000208v1_random:8075-8097 AATCTGCTCTATCAAAAGGAAGG + Intergenic
1202772829 5_GL000208v1_random:28212-28234 GTACTGCTCTATCAATAGGACGG + Intergenic
1202774177 5_GL000208v1_random:48783-48805 AAACTGCTCTATCAAAAAGAAGG + Intergenic
1202774399 5_GL000208v1_random:53047-53069 AATCTGCTCTATCAAAAGGAAGG + Intergenic
1202774533 5_GL000208v1_random:55945-55967 AAACTGCTCTATCAATAGGAAGG + Intergenic
1003844803 6:10161905-10161927 GATCTTCTCTACCAATAAGAGGG + Intronic
1009254722 6:61371914-61371936 AAACTGCTCTATCAAAAAGAAGG - Intergenic
1009255380 6:61385865-61385887 AATCTGCTCTATCAAAAGGAAGG - Intergenic
1009255531 6:61389602-61389624 AAACTGCTCTATCAAAAAGAAGG - Intergenic
1009858663 6:69295898-69295920 GTTCTGCTATGTGAATAAGAAGG - Intronic
1010778029 6:79909112-79909134 GGTCTACTGTTTCAATAAGAAGG + Intergenic
1012345550 6:98180874-98180896 GATCTGATTTCTTGATAAGAGGG - Intergenic
1015205007 6:130626977-130626999 GATCTGATCTCTCGATCAGGAGG + Intergenic
1017317474 6:153048519-153048541 GAACTTCACTCTGAATAAGATGG - Intronic
1017826505 6:158085909-158085931 GATGTGCTCTTCCCATAAGAAGG + Intronic
1021569572 7:22050978-22051000 GAGATTCTCTCTCATTAAGAGGG - Intergenic
1021815606 7:24444653-24444675 TATTTGCTCTCCCAAAAAGATGG - Intergenic
1025338643 7:58445263-58445285 AATCTGCTCTCTCTAAAACAAGG - Intergenic
1025428725 7:60042967-60042989 AATCTGCTCTCTCTATAGAAAGG - Intergenic
1025434048 7:60137678-60137700 AATCTGCTCTCTCTATAGAAAGG - Intergenic
1025465485 7:60697118-60697140 AATCTGCTCTGTCAAAACGAAGG - Intergenic
1025472944 7:60880247-60880269 AAACTGCTCTATCAAAAAGAAGG + Intergenic
1025473234 7:60885857-60885879 GATCTGCTCTATCAAAAGAACGG + Intergenic
1025490828 7:61119686-61119708 GAACTGCTCTATCAAAAGGAAGG - Intergenic
1025494224 7:61177784-61177806 GAACTGCTCTATCAAAAGGAAGG - Intergenic
1025499213 7:61263387-61263409 AAACTGCTCTATCAAAAAGAAGG - Intergenic
1025499306 7:61265513-61265535 AAACTGCTCTATCAAAAAGATGG - Intergenic
1025513771 7:61604009-61604031 GATCTGCTCTATCAAAAGAACGG - Intergenic
1025514060 7:61609619-61609641 AAACTGCTCTATCAAAAAGAAGG - Intergenic
1025514157 7:61611745-61611767 AAACTGCTCTATCAAAAAGATGG - Intergenic
1025537396 7:61971254-61971276 AATCTGCTCTCTCTATAGCAAGG - Intergenic
1025538116 7:62032848-62032870 GATCTGCTCTATCAAAAGAACGG - Intergenic
1025538405 7:62038459-62038481 AAACTGCTCTATCAAAAAGAAGG - Intergenic
1025538501 7:62040585-62040607 AAACTGCTCTATCAAAAAGATGG - Intergenic
1025567988 7:62513117-62513139 AATCTGCTCTGTCAAAACGAAGG - Intergenic
1025568124 7:62515491-62515513 AATCTGCTCTGTCAAAACGAAGG - Intergenic
1025568296 7:62518546-62518568 GAACTGCTCTATCAAAAGGAAGG - Intergenic
1025568716 7:62526881-62526903 AAACTGCTCTCTCAAAATGAAGG - Intergenic
1025568772 7:62528073-62528095 AAACTGCTCTCTCAAAATGAAGG - Intergenic
1025568838 7:62529264-62529286 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
1032833540 7:135652544-135652566 GATCTGGTCACTCAATTGGAGGG - Intergenic
1033448386 7:141441377-141441399 GCTCTGCTCTATCTATGAGATGG - Intronic
1034059368 7:148072378-148072400 CTTCTGCTCTCACAATATGATGG - Intronic
1037071232 8:14652080-14652102 TTTCTGATCTCTCAATGAGACGG + Intronic
1038408025 8:27336506-27336528 GCTCTGTTCTCCCAATAAGGAGG + Intronic
1040140743 8:43908485-43908507 AAACTGCTCTATCAATAGGAAGG - Intergenic
1040746365 8:50647234-50647256 CATCTGCTCTATGAATAATAGGG + Intronic
1046244614 8:111542785-111542807 AATTAGCTCTCTCAGTAAGAGGG + Intergenic
1046818360 8:118609856-118609878 GCTCTGCTCTGTCTATCAGAGGG - Intronic
1047630119 8:126697683-126697705 GAAGTGCTCTCTCAAGATGATGG - Intergenic
1048240128 8:132732933-132732955 GGTCAGCTCTCTCAATGACAGGG - Intronic
1052399416 9:27981657-27981679 GATCTGCTCTCTCAATAAGAGGG - Intronic
1052525825 9:29618439-29618461 GAACTGCTTTCAAAATAAGAAGG + Intergenic
1053687841 9:40557569-40557591 AAACTGCTCTATCAAAAAGAAGG - Intergenic
1053952201 9:43405524-43405546 AAACTGCTCTGTCAATAGGAAGG - Intergenic
1053958497 9:43514781-43514803 AAACTGCTCTGTCAAAAAGAAGG - Intergenic
1053966410 9:43652614-43652636 AATCTGCTCTTTCAAAAGGAAGG - Intergenic
1054055581 9:45188351-45188373 AAACTGCTCTCTCAAAATGAAGG - Intergenic
1056580155 9:87884342-87884364 CATTTGCTCTCCCAACAAGATGG + Intronic
1203418162 Un_KI270366v1:3809-3831 AATCTGCTCTATCAAAAGGAAGG + Intergenic
1203418297 Un_KI270366v1:6707-6729 AAACTGCTCTATCAATAGGAAGG + Intergenic
1203420391 Un_KI270373v1:749-771 AAACTGCTCTATCAAAAAGATGG - Intergenic
1203419478 Un_KI270393v1:715-737 AAACTGCTCTCTCAAAATGAAGG + Intergenic
1203340986 Un_KI270411v1:1492-1514 AATCTGCTCTCTCTAAAGGAAGG + Intergenic
1203341053 Un_KI270414v1:173-195 AATCTGCTCTCTCTAAAGGAAGG - Intergenic
1203378079 Un_KI270467v1:562-584 AATCTGCTCTATCAATAGCAAGG - Intergenic
1203405873 Un_KI270538v1:506-528 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
1203405884 Un_KI270538v1:677-699 GAACTGCTCTATCAAAAGGACGG - Intergenic
1203405908 Un_KI270538v1:1189-1211 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
1203406049 Un_KI270538v1:3916-3938 AAACTTCTCTCTCAAAAAGAAGG - Intergenic
1203406263 Un_KI270538v1:17555-17577 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
1203406421 Un_KI270538v1:20952-20974 AAACTGCTCTCTCAAGAGGAAGG - Intergenic
1203406531 Un_KI270538v1:23512-23534 AAACTGCTCTCTCAAAAGGAAGG - Intergenic
1203407627 Un_KI270538v1:58363-58385 AAACTGCTCTCTCAAAAGGAAGG + Intergenic
1203407675 Un_KI270538v1:59384-59406 AAACTGCTCTCTCAAAAGGAAGG + Intergenic
1203407874 Un_KI270538v1:63164-63186 AAACTGCTCTCTCAAAAGGAAGG + Intergenic
1203407923 Un_KI270538v1:64186-64208 AAACTGCTCTCTCAAAAGGAAGG + Intergenic
1203407959 Un_KI270538v1:64868-64890 AAACTGCTCTCTCAAAAGGAAGG + Intergenic
1203408669 Un_KI270538v1:72608-72630 AAACTGCTCTCTCAAAAGGAAGG + Intergenic
1203408722 Un_KI270538v1:73459-73481 AAACTGCTCTCTCAAAAGGAAGG + Intergenic
1203408842 Un_KI270538v1:75675-75697 AAACTGCTCTCTCAAAAGGAAGG + Intergenic
1203408936 Un_KI270538v1:77553-77575 TAACTGCTCTCTCAAAAGGAAGG + Intergenic
1203408976 Un_KI270538v1:78406-78428 AAACTGCTCTCTCAAAAGGAAGG + Intergenic
1203409090 Un_KI270538v1:80452-80474 AAACTGCTCTCTCAAAAGGAAGG + Intergenic
1203409149 Un_KI270538v1:81481-81503 AAACTGCTCTCTCAAAAGGAAGG + Intergenic
1203409297 Un_KI270538v1:87548-87570 AATCTGCTGTCTCAAAAGGAAGG + Intergenic
1203409342 Un_KI270538v1:88406-88428 AAACTGCTCTCTCAAAAGGAAGG + Intergenic
1186153686 X:6703667-6703689 GTTTTCCTCTCTCAATAATATGG + Intergenic
1191564461 X:62507178-62507200 AAACTGCTCTCTCAAAAGGAAGG + Intergenic
1191564561 X:62509049-62509071 AAACTGCTCTCTCAAAAGGAAGG + Intergenic
1191564693 X:62511605-62511627 AAACTGCTCTCTCAAAAGGAAGG + Intergenic
1191564767 X:62513309-62513331 AAACTGCTCTCTCAAAAGGAAGG + Intergenic
1191564813 X:62514334-62514356 AAACTGCTCTCTCAAAAGGAAGG + Intergenic
1191564820 X:62514505-62514527 AAACTGCTCTCTCAAAAGGAAGG + Intergenic
1191569558 X:62593169-62593191 GAACTGCTCTATCAAAAGGAAGG - Intergenic
1191570119 X:62603217-62603239 AATCTGCTCTATCAAAAGGAAGG - Intergenic
1191570139 X:62603559-62603581 AATCTGCTCTATCAAAAGGAAGG - Intergenic
1193094160 X:77528236-77528258 GATCTGATCTCTCCATGGGAGGG + Intronic
1194594913 X:95845944-95845966 GACCTGCTCTCTCAATCTGTTGG + Intergenic
1198748990 X:139920028-139920050 AATGTGCTCTCTCCATAAAACGG + Intronic
1198853522 X:140991394-140991416 CAAATGCTCTCTCCATAAGAAGG - Intergenic
1201990352 Y:20017071-20017093 GTTCTACTCTCTCAAAAAGTGGG + Intergenic