ID: 1052399417

View in Genome Browser
Species Human (GRCh38)
Location 9:27981658-27981680
Sequence AGATCTGCTCTCTCAATAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 128}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052399417_1052399420 22 Left 1052399417 9:27981658-27981680 CCTCTTATTGAGAGAGCAGATCT 0: 1
1: 0
2: 0
3: 15
4: 128
Right 1052399420 9:27981703-27981725 AAGGTCCAGAAAGAAAAACATGG No data
1052399417_1052399418 3 Left 1052399417 9:27981658-27981680 CCTCTTATTGAGAGAGCAGATCT 0: 1
1: 0
2: 0
3: 15
4: 128
Right 1052399418 9:27981684-27981706 TTGTCCATCTAGATTAGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052399417 Original CRISPR AGATCTGCTCTCTCAATAAG AGG (reversed) Intronic
904926488 1:34053008-34053030 TGGACAGCTCTCTCAATAAGTGG + Intronic
910751933 1:90640600-90640622 AAGCCTGCTTTCTCAATAAGGGG - Intergenic
910864775 1:91778102-91778124 AGATCTGGTCTCTGAATACTTGG - Intronic
912617157 1:111114442-111114464 AAATCTGTTCTTTCAATAACTGG - Intergenic
913932571 1:124994549-124994571 AAAACTGCTCTCTCAAAAGGAGG + Intergenic
917240190 1:172939717-172939739 AGAGCAGCTCTCTGAAGAAGGGG + Intergenic
917262301 1:173183380-173183402 ACATCTGCTGTCTCAATAAAAGG - Intergenic
921515851 1:216090937-216090959 AGATCAGGTGTCTGAATAAGTGG + Intronic
921540096 1:216403887-216403909 AGATCTGATGGCTTAATAAGGGG + Intronic
1064311107 10:14212455-14212477 AGATCTGCTTTTCCATTAAGGGG - Intronic
1066826524 10:39592954-39592976 AAATCTGCTCTCTCTAAAGGAGG - Intergenic
1069224430 10:65924295-65924317 AGATCTGCCCTCTCCATAGCGGG + Intronic
1076460276 10:130639145-130639167 AGATCTGATTTGTCAAAAAGAGG - Intergenic
1079475370 11:20824137-20824159 AGATCTGCTGGCTTTATAAGGGG + Intronic
1080703125 11:34662209-34662231 AGATATGGTCTCCCAATCAGAGG - Intergenic
1081171915 11:39880196-39880218 GGATTTGCTTTCTCACTAAGAGG + Intergenic
1090495766 11:127210630-127210652 AGATTTTCTTTCTCCATAAGTGG + Intergenic
1091206837 11:133827314-133827336 AGATCAGCTCTCTCTAAATGTGG + Intergenic
1092225131 12:6743479-6743501 AGATCTGATGGCTCTATAAGGGG + Intergenic
1092799955 12:12154687-12154709 AGACCTGATCTCTTAAAAAGAGG + Intronic
1093168475 12:15832672-15832694 GAATCTCATCTCTCAATAAGAGG - Intronic
1094880066 12:34713185-34713207 AAAACTGCTCTATCAAAAAGAGG + Intergenic
1094899304 12:35089280-35089302 AAATCTGCTCTGTCTAAAAGAGG - Intergenic
1094910247 12:35265900-35265922 AAATCTGCTCTGTCTAAAAGAGG - Intergenic
1094924325 12:35494167-35494189 AAATCTGCTCTGTCTAAAAGAGG - Intergenic
1094957911 12:36038125-36038147 AAATCTGCTCTGTCTAAAAGAGG - Intergenic
1094984997 12:36475687-36475709 AAATCTGCTCTGTCTAAAAGAGG - Intergenic
1094989178 12:36543645-36543667 AAATCTGCTCTGTCTAAAAGAGG - Intergenic
1094996442 12:36660836-36660858 AAATCTGCTCTGTCTAAAAGAGG - Intergenic
1095013142 12:36931618-36931640 AAATCTGCTCTGTCTAAAAGAGG - Intergenic
1096088495 12:48882695-48882717 AGGTCTGCCCTCTCAATAGGGGG - Intergenic
1096582111 12:52592346-52592368 AGATCTGCTCCTTTAACAAGAGG - Intronic
1098686332 12:73425527-73425549 AGATCTGATGTTTTAATAAGGGG - Intergenic
1098870926 12:75816026-75816048 AAATCTGATCTCACAAGAAGGGG + Intergenic
1100071043 12:90718344-90718366 TGATCTGATATCTCAATATGTGG - Intergenic
1102745716 12:115247270-115247292 AGATGTTCTCACTTAATAAGTGG + Intergenic
1103135232 12:118501347-118501369 AGAACTGATCTATTAATAAGTGG + Intergenic
1105155986 13:17351118-17351140 AAAACTGCTCTGTCAAAAAGAGG - Intergenic
1108665546 13:52626261-52626283 AGAACTGCCATCTCAATAAGTGG - Intergenic
1112083246 13:95999857-95999879 ACATCTGTTCTTGCAATAAGGGG + Intronic
1115076254 14:29394993-29395015 AGATCTTCTCTCTCATTGGGAGG + Intergenic
1117449738 14:55839331-55839353 AGGACTGCCCTCTCAATATGAGG - Intergenic
1122440469 14:101728187-101728209 AGATCTGATGGTTCAATAAGGGG + Intergenic
1130154274 15:81336240-81336262 AGATCTGCTGTCTCAGTTAGTGG - Intronic
1131362687 15:91807314-91807336 AGATCAGCTATGTCAATATGTGG - Intergenic
1131596234 15:93800990-93801012 AGACCTGCTTTCTCCACAAGGGG + Intergenic
1132865861 16:2092420-2092442 AAGGCTGCTCTCTCAACAAGAGG + Intronic
1134470660 16:14522497-14522519 AGACTTGGTCTCTTAATAAGAGG + Intronic
1138529469 16:57627267-57627289 AGATCTGCCTTCTAAACAAGGGG - Intronic
1138872114 16:60903059-60903081 AGACCTACTCTCTCAATACTGGG - Intergenic
1139213165 16:65100929-65100951 AGAACTGCTCCCTTGATAAGAGG - Intronic
1140174957 16:72649284-72649306 AGACTTCATCTCTCAATAAGAGG - Intergenic
1141312809 16:82931745-82931767 AGATCTGATGTTTCTATAAGGGG - Intronic
1146829957 17:36059976-36059998 AGATCTCATCTATCAATGAGAGG + Intergenic
1153301220 18:3593759-3593781 AGATCTGCTCTCCCCAGAAGAGG - Intronic
1154223525 18:12478849-12478871 AGATCTTCCCTCTCCACAAGGGG + Intronic
1156891843 18:42199138-42199160 AGAACTGATGTCTCTATAAGAGG - Intergenic
1157212577 18:45756381-45756403 AGATCTACCCTCTCATTGAGAGG - Intergenic
1157959837 18:52140986-52141008 AAATCTGTTCTCTCTGTAAGTGG + Intergenic
1159538527 18:69746038-69746060 AGAGCTGCTCTTTGAATAAAAGG - Intronic
1163331385 19:16640536-16640558 AGATCTGCTCTCTTCTGAAGTGG - Intronic
1164662057 19:29983247-29983269 AGATCTCCTCTATCAAGATGAGG - Intronic
1164898171 19:31895745-31895767 AAATCTGCTCTTTCAATTAGCGG - Intergenic
1164929774 19:32166460-32166482 ACAGCTGCTCTGTCAATAAATGG - Intergenic
1166425280 19:42672419-42672441 ATATCTGCTCTCTTTATAACAGG + Intronic
1166430435 19:42721615-42721637 GGATCTGCTCTCTTTATAACAGG - Intronic
1166443462 19:42836970-42836992 GGATCTGCTCTCTTTATAACAGG - Intronic
1166480428 19:43167716-43167738 GGATCTGCTCTCTTTATAACAGG - Intronic
928796822 2:35033335-35033357 AGATCTGCTCTCAATGTAAGTGG - Intergenic
928930929 2:36623371-36623393 AGACCTGCTGTCTCAAAAATTGG - Intronic
929945276 2:46366743-46366765 TCATCTGCTCTCTCCATCAGGGG - Intronic
931327943 2:61247445-61247467 AATTCTGCTCTCTCCACAAGTGG + Intronic
932212936 2:69946900-69946922 TGATCTGGTCTCTCTATGAGAGG - Intergenic
937144771 2:119634872-119634894 AAATCTGCTCTCACAATCTGCGG + Intronic
938974393 2:136461599-136461621 ACATTTGGTATCTCAATAAGTGG - Intergenic
946174266 2:217912978-217913000 AGATCTGATCTCACATTGAGCGG - Intronic
1169639254 20:7731566-7731588 AGATCTGATGGCTTAATAAGGGG - Intergenic
1171575932 20:26317110-26317132 AGAACTGCTCTCTCAAAAGAAGG - Intergenic
1171576066 20:26319842-26319864 AGAACTGCTCTCTCAAAAGAAGG - Intergenic
1175066122 20:56290464-56290486 AGATCTCCCCTCTCAAAATGAGG - Intergenic
1179779358 21:43689551-43689573 AGCGCTGCTCCCTCACTAAGAGG + Intronic
952256524 3:31700217-31700239 ATGTCTGCTCTTTCAAGAAGAGG + Intronic
952823895 3:37508960-37508982 AGATCTGCTCTCTCTGGAGGTGG - Intronic
957228146 3:77475522-77475544 AGATCTGCTCTCCTAAAAAATGG - Intronic
958403400 3:93719493-93719515 AAATCTGCTCTATCAAAAGGAGG + Intergenic
959374991 3:105578601-105578623 AGATCTTTTCTCTCATTCAGAGG - Intergenic
963116958 3:141738424-141738446 AGATGTTCTCCCTCAAGAAGTGG + Exonic
964870053 3:161303607-161303629 AGATCTGATGTCTTCATAAGTGG + Intergenic
971753185 4:30677302-30677324 AGATCTGATGATTCAATAAGGGG + Intergenic
972011073 4:34182888-34182910 AGATCTGCTATGTTTATAAGGGG - Intergenic
977228166 4:94418851-94418873 AGATCCCCTCTCCCAATAACAGG + Intergenic
977602388 4:98948391-98948413 AGATCTGCTCTCTTTATAACAGG + Intergenic
978717137 4:111858434-111858456 AGAGCTGCCCTCTCAATCAGAGG - Intergenic
980703941 4:136468092-136468114 ATTTCTTCTCTCACAATAAGAGG + Intergenic
981688235 4:147479356-147479378 AGATCAGCTGTCTCAATAGGTGG + Intergenic
981816213 4:148833651-148833673 AGAGCTACTCTCTAAATAATTGG - Intergenic
982729155 4:158936986-158937008 AGATATGCTCTCTCGAGAAGGGG - Intronic
989819988 5:45785491-45785513 AGATCTGCTATCACTAGAAGAGG - Intergenic
989858810 5:46338412-46338434 AAAACTGCTCTATCAAAAAGAGG + Intergenic
989896273 5:47089822-47089844 AAATCTGCTCTATCAAAAGGAGG + Intergenic
989896753 5:47098878-47098900 AAAACTGCTCTCTCAAAAGGAGG + Intergenic
991512150 5:67391053-67391075 ATCTCTGCTCTCTCCATTAGTGG + Intergenic
992266677 5:75025247-75025269 AACTCTGCTCTTTAAATAAGGGG + Intergenic
993210364 5:84942010-84942032 TGAACTGCTCTCTCAGTAAAAGG - Intergenic
996895227 5:128473180-128473202 AGAACTGCTCTCTAAATAGGTGG + Intronic
996905510 5:128595399-128595421 ATATGTTCTCTCTCAGTAAGAGG - Intronic
998060654 5:139116208-139116230 AGATCTGCACGAGCAATAAGAGG - Intronic
1000099330 5:157999920-157999942 ACAACTGCTCTGTGAATAAGAGG + Intergenic
1202771951 5_GL000208v1_random:13180-13202 AAATCTGCTCTATCAAAAGGAGG + Intergenic
1003156185 6:3597385-3597407 AGATTTGCTTTCTCGATAAAAGG + Intergenic
1003655193 6:8000591-8000613 AAATCTGGTCTCTAGATAAGAGG + Intronic
1003844802 6:10161904-10161926 GGATCTTCTCTACCAATAAGAGG + Intronic
1003964073 6:11236565-11236587 AGCTCTGCCCTCTCTATGAGTGG - Intronic
1005190655 6:23218732-23218754 AGATCTGATGTATCAATAGGAGG + Intergenic
1005317898 6:24621944-24621966 AGAACTGCTCTCTCAAGAGACGG + Intronic
1006967435 6:38002810-38002832 AGATCTGCTCTCTCATCTACTGG - Intronic
1009946055 6:70342663-70342685 AGATCTGATCACTTTATAAGGGG - Intergenic
1010410749 6:75558859-75558881 AGATCTGCTCTCTGAAGAAATGG + Intergenic
1010527939 6:76926040-76926062 AGATCTGATCACTTTATAAGGGG + Intergenic
1012113679 6:95266198-95266220 AGCTTTGCTCTCTAAATAAGTGG - Intergenic
1016149129 6:140717255-140717277 TGTTCTACTCTCTCAATAATAGG + Intergenic
1021569573 7:22050979-22051001 AGAGATTCTCTCTCATTAAGAGG - Intergenic
1023168750 7:37369789-37369811 AGATATCTTCTCTCAATATGTGG - Intronic
1028184913 7:87771579-87771601 AGAGCTACTCTCTCAAGAAAAGG + Intronic
1028829303 7:95309896-95309918 AGTTCTGCTCTCTCAATCCAAGG - Intronic
1030425131 7:109367157-109367179 AGATCTGATGTTTCTATAAGGGG + Intergenic
1037065437 8:14571197-14571219 AGATCTGCTCTTTCTGTAAGTGG - Intronic
1037403553 8:18518021-18518043 AGATCTGATCACTTTATAAGGGG - Intergenic
1038804006 8:30774237-30774259 AGATCTGATGTTTCTATAAGGGG - Intergenic
1043242258 8:77949485-77949507 AGATCTGCTTTCTCAATCTATGG + Intergenic
1043660755 8:82737011-82737033 AGATCTGATGGCTCTATAAGGGG + Intergenic
1048017573 8:130511349-130511371 AGATCTTATCTCTAAAAAAGGGG - Intergenic
1048240129 8:132732934-132732956 AGGTCAGCTCTCTCAATGACAGG - Intronic
1052399417 9:27981658-27981680 AGATCTGCTCTCTCAATAAGAGG - Intronic
1054885708 9:70196106-70196128 AGATCTGCTCATTTAATAAATGG - Intronic
1056286328 9:85091164-85091186 AGATCTGCTGGTTCTATAAGGGG + Intergenic
1193094159 X:77528235-77528257 AGATCTGATCTCTCCATGGGAGG + Intronic
1197347333 X:125340247-125340269 AGATCTGTTTTTTCCATAAGAGG - Intergenic
1199064241 X:143395510-143395532 AGATCTGCTCTAAATATAAGCGG - Intergenic
1201990351 Y:20017070-20017092 AGTTCTACTCTCTCAAAAAGTGG + Intergenic
1202162245 Y:21947178-21947200 AGATAGGCTCTCTCTAGAAGAGG + Intergenic
1202229111 Y:22639195-22639217 AGATAGGCTCTCTCTAGAAGAGG - Intergenic
1202314043 Y:23556970-23556992 AGATAGGCTCTCTCTAGAAGAGG + Intergenic
1202556759 Y:26113625-26113647 AGATAGGCTCTCTCTAGAAGAGG - Intergenic