ID: 1052399418

View in Genome Browser
Species Human (GRCh38)
Location 9:27981684-27981706
Sequence TTGTCCATCTAGATTAGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052399417_1052399418 3 Left 1052399417 9:27981658-27981680 CCTCTTATTGAGAGAGCAGATCT 0: 1
1: 0
2: 0
3: 15
4: 128
Right 1052399418 9:27981684-27981706 TTGTCCATCTAGATTAGTGAAGG No data
1052399416_1052399418 4 Left 1052399416 9:27981657-27981679 CCCTCTTATTGAGAGAGCAGATC 0: 1
1: 0
2: 1
3: 30
4: 1739
Right 1052399418 9:27981684-27981706 TTGTCCATCTAGATTAGTGAAGG No data
1052399415_1052399418 5 Left 1052399415 9:27981656-27981678 CCCCTCTTATTGAGAGAGCAGAT 0: 1
1: 0
2: 1
3: 13
4: 151
Right 1052399418 9:27981684-27981706 TTGTCCATCTAGATTAGTGAAGG No data
1052399414_1052399418 24 Left 1052399414 9:27981637-27981659 CCTAAGGACTGCTGTTGTTCCCC 0: 1
1: 0
2: 0
3: 17
4: 146
Right 1052399418 9:27981684-27981706 TTGTCCATCTAGATTAGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052399418 Original CRISPR TTGTCCATCTAGATTAGTGA AGG Intronic
No off target data available for this crispr