ID: 1052401669

View in Genome Browser
Species Human (GRCh38)
Location 9:28008077-28008099
Sequence GATGACAAACGATGTAAGAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 64}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052401669_1052401675 20 Left 1052401669 9:28008077-28008099 CCCGTCTTACATCGTTTGTCATC 0: 1
1: 0
2: 0
3: 1
4: 64
Right 1052401675 9:28008120-28008142 GAGAGGTCTGCAAAGGTGAGTGG No data
1052401669_1052401671 -2 Left 1052401669 9:28008077-28008099 CCCGTCTTACATCGTTTGTCATC 0: 1
1: 0
2: 0
3: 1
4: 64
Right 1052401671 9:28008098-28008120 TCAGAATCTCCTTCACTCTCAGG No data
1052401669_1052401672 3 Left 1052401669 9:28008077-28008099 CCCGTCTTACATCGTTTGTCATC 0: 1
1: 0
2: 0
3: 1
4: 64
Right 1052401672 9:28008103-28008125 ATCTCCTTCACTCTCAGGAGAGG No data
1052401669_1052401674 13 Left 1052401669 9:28008077-28008099 CCCGTCTTACATCGTTTGTCATC 0: 1
1: 0
2: 0
3: 1
4: 64
Right 1052401674 9:28008113-28008135 CTCTCAGGAGAGGTCTGCAAAGG No data
1052401669_1052401676 21 Left 1052401669 9:28008077-28008099 CCCGTCTTACATCGTTTGTCATC 0: 1
1: 0
2: 0
3: 1
4: 64
Right 1052401676 9:28008121-28008143 AGAGGTCTGCAAAGGTGAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052401669 Original CRISPR GATGACAAACGATGTAAGAC GGG (reversed) Intronic
903140711 1:21337587-21337609 GATGACACAGGATGCCAGACTGG - Intronic
903168775 1:21539401-21539423 GATGACAAAATATGTAAAATAGG + Intronic
906044207 1:42815825-42815847 GAAGTAAAAGGATGTAAGACAGG + Intronic
908916983 1:69139662-69139684 GATGATAAACCATAAAAGACAGG + Intergenic
923846861 1:237743903-237743925 GATGACAAACTTTTTAAGCCAGG + Intronic
1069296765 10:66855657-66855679 GATGAAAAACAATATAAGATAGG + Intronic
1072795658 10:98352581-98352603 GAAGACAAACGAGGAAAGAAAGG - Intergenic
1073940151 10:108688266-108688288 GATGTCAAAGGATGGAAGAATGG + Intergenic
1077895420 11:6449853-6449875 GATGAGAAATGATGTGAGCCTGG - Intronic
1088124920 11:106412872-106412894 GATGACAAACGATGAAGGAAGGG - Intergenic
1091784879 12:3237312-3237334 GATGACTTACGATCAAAGACAGG + Intronic
1093858389 12:24133607-24133629 GATGCCAAACAATGCAAGAGAGG + Intergenic
1094417941 12:30237062-30237084 GATGACAAAGGTTCTTAGACAGG + Intergenic
1095875103 12:47071500-47071522 GATGACAGACATTGAAAGACTGG + Intergenic
1099505555 12:83471699-83471721 GGTGAGAAAAGAAGTAAGACAGG - Intergenic
1112405393 13:99115297-99115319 AATGTCAAACGATGTCAGATGGG + Intergenic
1114195498 14:20472584-20472606 GAAGACAAATGTTGTAAGAGAGG + Intronic
1115425566 14:33254988-33255010 AATGAGAAAAGAAGTAAGACTGG - Intronic
1117581516 14:57156233-57156255 GATGACTAATGATGCAACACAGG + Intergenic
1130068404 15:80626231-80626253 GATGAAAAAGTATGCAAGACTGG - Intergenic
1130787231 15:87113937-87113959 GATGGCAGATGATGTAAGGCAGG + Intergenic
1137902181 16:52280591-52280613 AATGACAAATAATTTAAGACAGG - Intergenic
1137956021 16:52830470-52830492 GATGATAAACAATGTATGCCTGG + Intergenic
1138871983 16:60901548-60901570 GACCACAAACCATGTATGACTGG - Intergenic
1140964104 16:79947504-79947526 GATGAGAAATTAAGTAAGACAGG + Intergenic
1142928277 17:3260004-3260026 GAGGAGACACAATGTAAGACAGG - Intergenic
1145823289 17:27857233-27857255 GATGACAGAGGATGAAAGAGAGG + Intronic
1150777832 17:68095974-68095996 GAGGACAAGGGCTGTAAGACAGG + Intergenic
1150915060 17:69428484-69428506 GATGACAGATGATGTCATACTGG - Intronic
1165208392 19:34211447-34211469 TATGATAAATAATGTAAGACAGG + Intronic
938623961 2:133088344-133088366 GGGGACAAATGAGGTAAGACTGG - Intronic
940125654 2:150320769-150320791 GATGACAAAGGAAGTCAGATTGG + Intergenic
940972724 2:159911212-159911234 GATCACAAAGAATGAAAGACCGG - Intergenic
945658501 2:212655295-212655317 CATGGCAAACAATGTATGACTGG - Intergenic
947429231 2:230011098-230011120 GAGGACAAGGGCTGTAAGACAGG + Exonic
947987374 2:234460535-234460557 AATGACATACGATTTAAAACTGG - Intergenic
1174393900 20:50234232-50234254 GATGACAGAGGATGACAGACAGG + Intergenic
1183736222 22:39646295-39646317 GATGACAAAGAGAGTAAGACGGG - Intronic
1184056396 22:42053413-42053435 GATGACTAACAATGTAACATGGG + Intronic
949237165 3:1823184-1823206 CATAACAAACCATGTCAGACTGG - Intergenic
949440887 3:4079032-4079054 GATGACAAACAATGTCACATAGG - Intronic
955988247 3:64597679-64597701 CATGACAAACCATGAAAGAGAGG - Intronic
957153252 3:76513783-76513805 GATGACAAATGAAATAAGATTGG - Intronic
960119332 3:113931259-113931281 GAGGACAAAGGAAGCAAGACTGG + Intronic
973595420 4:52483850-52483872 GGTGACAAAGGATGGAAGAAGGG - Intergenic
981274692 4:142884813-142884835 GATGACAAGTCAGGTAAGACAGG - Intergenic
993432564 5:87849777-87849799 GATGAAAATGGATGTGAGACAGG - Intergenic
996145430 5:119969062-119969084 GATGAGAACCCATGTAATACTGG - Intergenic
998256973 5:140595295-140595317 GAGAACAAAAGAAGTAAGACTGG - Intergenic
999178300 5:149647671-149647693 CATGACAAAGGATGAAAGAGAGG + Intergenic
1005605968 6:27477779-27477801 GAGGAGAAACGAAGGAAGACCGG - Intergenic
1007010585 6:38413499-38413521 GCTGAGAAAAGATGTAAAACAGG - Intronic
1013389373 6:109667791-109667813 GATGTCCAACGATGATAGACTGG - Intronic
1015346849 6:132170639-132170661 GATGACTAACAAAGTAAGAAAGG - Intergenic
1024057769 7:45675951-45675973 GAAGAAAAAGGGTGTAAGACTGG - Intronic
1024933719 7:54690894-54690916 GAGGACAAAAAATGTAAGAAAGG + Intergenic
1031516918 7:122712161-122712183 GATGACAACCTTTGTAAGAGGGG - Intronic
1033114569 7:138613822-138613844 ATTGACAAATGATGTAAGTCAGG - Intronic
1035187913 7:157139976-157139998 GATCACAACAGATGTAAGTCCGG - Intronic
1051950521 9:22626054-22626076 GATGAAGTACAATGTAAGACTGG + Intergenic
1052401669 9:28008077-28008099 GATGACAAACGATGTAAGACGGG - Intronic
1059539429 9:115116094-115116116 GATGACAAACTATGTCTCACAGG - Intronic
1186793531 X:13022498-13022520 TATGACAAACGATGTCATTCTGG - Intergenic
1188115709 X:26239813-26239835 TATAACAAACTATGTGAGACTGG + Intergenic
1198805180 X:140487229-140487251 GATGAAAAAGGATGGAAGAAAGG - Intergenic
1199704220 X:150410103-150410125 AATGACAAACAATGTAAGGTGGG - Intronic