ID: 1052403517

View in Genome Browser
Species Human (GRCh38)
Location 9:28030779-28030801
Sequence GTACAATTAAGGGCAAAAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052403512_1052403517 15 Left 1052403512 9:28030741-28030763 CCTACTATCAACAGCACACTACA 0: 1
1: 0
2: 1
3: 15
4: 178
Right 1052403517 9:28030779-28030801 GTACAATTAAGGGCAAAAAGTGG No data
1052403511_1052403517 16 Left 1052403511 9:28030740-28030762 CCCTACTATCAACAGCACACTAC 0: 1
1: 0
2: 0
3: 15
4: 319
Right 1052403517 9:28030779-28030801 GTACAATTAAGGGCAAAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052403517 Original CRISPR GTACAATTAAGGGCAAAAAG TGG Intronic
No off target data available for this crispr