ID: 1052406837

View in Genome Browser
Species Human (GRCh38)
Location 9:28072033-28072055
Sequence ATGTAGAAGGAGGATGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1059
Summary {0: 1, 1: 1, 2: 7, 3: 96, 4: 954}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052406837 Original CRISPR ATGTAGAAGGAGGATGAAGA TGG (reversed) Intronic
900919986 1:5663934-5663956 ATGGAGATGGAGACTGAAGAGGG + Intergenic
901189071 1:7393843-7393865 CTGGAGAGGGAGGATGAAGAGGG - Intronic
901305163 1:8227477-8227499 ATGAAGTAGGTGGAGGAAGATGG + Intergenic
901670763 1:10855273-10855295 TTGTTGAAGGATGATGAAGGTGG - Intergenic
902489575 1:16771412-16771434 AAGAAGAAGAAGGAGGAAGAGGG + Intronic
903404867 1:23087903-23087925 ATGGAGAAGGAGGAACAGGAGGG + Exonic
903491079 1:23729081-23729103 ATCTTGAAGGAGGAGGAGGAAGG - Intergenic
904295762 1:29518859-29518881 AAGGAGAAGGAGAATGAGGAAGG - Intergenic
904295769 1:29518898-29518920 AAGAAGAAGGAGAAGGAAGAAGG - Intergenic
904401179 1:30257705-30257727 ATGTAAAATGAGGATGAAAAGGG + Intergenic
904455027 1:30642343-30642365 ATGTAAAATGAGGATGAAAAGGG + Intergenic
904797849 1:33070858-33070880 AAGGAGGAGGAAGATGAAGAAGG + Intronic
905575873 1:39044234-39044256 AAGGAGAAGGCGGAAGAAGAAGG + Intergenic
905912925 1:41666042-41666064 ATGGGGATGGAGGATGGAGAGGG - Intronic
906097410 1:43233745-43233767 AGGTAAAAGCATGATGAAGAGGG + Intronic
906170202 1:43718589-43718611 CTGTTGAAGGAGGGAGAAGAAGG - Intronic
906180828 1:43817431-43817453 AAGAAGAAGGAGAAGGAAGAAGG - Intronic
906938271 1:50233774-50233796 AAGTTGGAGGAAGATGAAGAAGG - Intergenic
907359747 1:53904894-53904916 AGGTGGAAGGAGGAAGAGGAGGG + Intronic
907362003 1:53925163-53925185 AAGTTGAAGGAGGAAGAAGAGGG - Intronic
907539333 1:55198345-55198367 ATGGAAATGGAGGATGAAGTCGG + Intronic
909288123 1:73847122-73847144 ATGTTGAGGGAAGAGGAAGAAGG - Intergenic
910007902 1:82422289-82422311 GTGAAGTAGGAGGAGGAAGAAGG + Intergenic
910698931 1:90051169-90051191 ATGCAGAGGAGGGATGAAGAAGG - Intergenic
910719091 1:90265873-90265895 GTGTAGGAGGAGGATGAAGATGG + Intergenic
910775271 1:90868446-90868468 ATGCAAAAGGAGCATGAAGGTGG - Intergenic
911063060 1:93764335-93764357 ATGGAGAAAGAGGATGAAGGAGG - Intronic
911525368 1:98978349-98978371 ATGGAGAAGAAGATTGAAGATGG - Intronic
911653164 1:100412485-100412507 ATGAAGAAGGAGGAAGGAAAAGG - Intronic
912141230 1:106730915-106730937 AGAAAGAAGGAGGAAGAAGAAGG + Intergenic
913153142 1:116065660-116065682 ATGGAGAAGGAGGTGGAAAAGGG - Intronic
913356892 1:117931671-117931693 CTGTAGAAGGAGGTGGTAGATGG + Intronic
913612540 1:120522253-120522275 ATGTGGAAAGGGGATAAAGAGGG + Intergenic
913691177 1:121281339-121281361 AAGAAGAAAGAGAATGAAGAAGG - Intronic
913986958 1:143574403-143574425 AGGTAGAAGGTGGAGTAAGATGG + Intergenic
914121092 1:144783186-144783208 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
914146365 1:144998633-144998655 AAGAAGAAAGAGAATGAAGAAGG + Intronic
914578651 1:148999994-149000016 ATGTGGAAAGGGGATAAAGAGGG - Intronic
914582730 1:149033571-149033593 AGGTAGAAGGTGGAGTAAGATGG + Intronic
915023011 1:152798674-152798696 AGTGAGAAGGAGGATGAAGTCGG - Intronic
915035307 1:152918726-152918748 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
915036872 1:152935186-152935208 ATGGAAAAGGAGGAGGAAAAAGG + Intergenic
915269888 1:154746517-154746539 GAGGAGAAGGAGGAAGAAGATGG - Intronic
915271374 1:154756065-154756087 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
915650124 1:157303567-157303589 AGGGAGAAGGTGCATGAAGATGG + Intergenic
916585133 1:166143639-166143661 ATGTGGAACCAGGAGGAAGAGGG + Intronic
916879240 1:169003289-169003311 AGAAAGAAGGAGGAGGAAGAAGG + Intergenic
916882336 1:169032026-169032048 AAGAAGAAGAAGGAAGAAGAAGG - Intergenic
917048483 1:170890932-170890954 AGGTAGGAAGAGGATGAAGCTGG - Intergenic
917174419 1:172217163-172217185 AGGTGTAAGGAGGCTGAAGAAGG - Intronic
917714276 1:177718438-177718460 AAGTTGAAGGAGACTGAAGAGGG - Intergenic
917819775 1:178750711-178750733 ATGCAGAAGGAGCAATAAGAAGG - Intronic
918069512 1:181124595-181124617 AAGCAGAAGGAGGAGGAGGAGGG - Intergenic
918601360 1:186366270-186366292 AAAGACAAGGAGGATGAAGATGG + Intronic
918990909 1:191696130-191696152 AGGTAGAAGCAAGATGGAGATGG - Intergenic
919142759 1:193593320-193593342 ATGGAGAAGGAGAAAGAAAAGGG - Intergenic
919595850 1:199561547-199561569 AAGGAGAAGGAGGAGGAGGAAGG - Intergenic
919739943 1:200975336-200975358 ATGGAGACAGAGGAGGAAGAGGG + Intronic
920478501 1:206299815-206299837 AAGAAGAAAGAGAATGAAGAAGG - Intronic
920567726 1:206988666-206988688 ATGTGGAAGAAGGAGGTAGAAGG + Intergenic
920756216 1:208736436-208736458 ATTTAGAAGGAGTAGGAAGAAGG + Intergenic
920757525 1:208748549-208748571 AGGGAGAAGGAAGGTGAAGAGGG - Intergenic
921353370 1:214261003-214261025 AAGGAGAAGGAGGAGGAGGAAGG - Intergenic
921418584 1:214919808-214919830 ATGGAGAAGGAGAATCAGGAAGG - Intergenic
921935640 1:220793902-220793924 ATGTGGCAGGAGCAGGAAGAAGG + Intronic
921976884 1:221212527-221212549 AAGTATAAGGAAGAAGAAGAAGG + Intergenic
922174742 1:223188738-223188760 ATAAAGAAGGAGGAGGAAGGGGG + Intergenic
922449268 1:225723636-225723658 AAGAAGAAGGAAGAAGAAGAAGG - Intergenic
922660660 1:227427691-227427713 ATGAAGTAGGTGGAAGAAGAAGG - Intergenic
923530862 1:234811113-234811135 AAGAAGAAGAAGGAGGAAGAGGG - Intergenic
924260974 1:242231217-242231239 AGGAAGAGGGAGGAGGAAGAGGG - Intronic
924432884 1:244012168-244012190 AAGTAGAAAGAAGATGAATATGG - Intergenic
924608669 1:245556299-245556321 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
924791519 1:247254682-247254704 ATGAAGTAGGAGGAAGGAGATGG - Intergenic
1063482244 10:6386001-6386023 AAGTTGCAGCAGGATGAAGAAGG + Intergenic
1063621037 10:7649314-7649336 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
1063743106 10:8847050-8847072 ATGTAGGTGGTGGATGAAGTAGG - Intergenic
1063873992 10:10452512-10452534 GTGGGGAAGGAGGTTGAAGAGGG - Intergenic
1063916065 10:10883905-10883927 AAGGAGGAGGAGGAGGAAGAGGG - Intergenic
1063961306 10:11307614-11307636 ATTTAAACGGAGGAAGAAGAAGG - Intronic
1064031038 10:11883041-11883063 AGGTAGAATGACAATGAAGATGG + Intergenic
1064244038 10:13655448-13655470 ATGAAGAAGGAACATAAAGAAGG + Exonic
1064272705 10:13879773-13879795 AGGGAGGAGGAGGAGGAAGAAGG - Intronic
1064631325 10:17315743-17315765 ATGGACAGGGAGGAAGAAGAGGG + Intergenic
1064767437 10:18688939-18688961 AAGGAAAAGGAGGAAGAAGAAGG - Intergenic
1064779284 10:18816686-18816708 ATGTAGAAAGTGGCTGGAGATGG + Intergenic
1064872594 10:19955425-19955447 ATGTAGAAAGGTGATGAAAAGGG - Intronic
1065387142 10:25144792-25144814 ATGGAGAATGAAGAAGAAGAAGG + Intergenic
1065761582 10:28987805-28987827 AAGGAGAAGTAGGAAGAAGAAGG - Intergenic
1065765652 10:29026997-29027019 GAGGAGAAGGAGGATGAAGAAGG + Intergenic
1065955567 10:30690791-30690813 ATGTAGAATGAGGCTGAGGCTGG + Intergenic
1067033657 10:42897897-42897919 AGGAGGAAGGAAGATGAAGAAGG - Intergenic
1067300024 10:44999907-44999929 ATCCAGAAGGTGGATGAAGGTGG + Exonic
1067476267 10:46568860-46568882 AAGGTGAAGGAGGATGATGAGGG + Intergenic
1067618470 10:47772920-47772942 AAGGTGAAGGAGGATGATGAGGG - Intergenic
1067699197 10:48556400-48556422 ATACAGAAGGAGGATAAAGGAGG - Intronic
1068113473 10:52709554-52709576 AAATAGAAGGAAGAAGAAGAAGG - Intergenic
1068123946 10:52814770-52814792 AAGTAGAAGGAAAAAGAAGAAGG - Intergenic
1069409525 10:68139075-68139097 ATGTTGGAGCAGGAGGAAGAAGG - Intronic
1069668738 10:70183598-70183620 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1070902931 10:80046718-80046740 ATGTAGAAGAAGGAAGGGGAAGG + Intergenic
1070976409 10:80609304-80609326 AGGTAAAAGGAGGAGGAGGAAGG - Intronic
1071242465 10:83723156-83723178 ATTTTTAGGGAGGATGAAGAGGG + Intergenic
1071510913 10:86262128-86262150 TTCTAGAAGGAGGAGGAAGCAGG + Intronic
1071731897 10:88256500-88256522 CTGAAGAAGGCGGATGGAGACGG - Intergenic
1072019378 10:91383130-91383152 GAGTAGAAGGAGGATGAAGCAGG - Intergenic
1072085630 10:92076755-92076777 AAGTAGAAGAAGGAAGAAGAAGG + Intronic
1072410820 10:95200581-95200603 ATGAAGAAAGAAGAAGAAGAAGG + Intronic
1072423526 10:95309728-95309750 ATCTAGAAAGAGGATGAAGAAGG + Intergenic
1072729328 10:97834630-97834652 ATGTAGAGAAAGGATGAAAAAGG + Intergenic
1073371659 10:102995189-102995211 AAGAGGAAGGAGGAGGAAGAGGG - Intronic
1073961996 10:108942647-108942669 ATTGAGAAAGAGGCTGAAGACGG - Intergenic
1074073040 10:110092576-110092598 AGGTAGCAGGAGGGTGAAGGCGG + Intronic
1074202938 10:111256058-111256080 CTCTAGAAGGAGGAGGAAGAGGG + Intergenic
1074561885 10:114542526-114542548 AGGAAGAAGGAGGAGGGAGAAGG + Intronic
1074732160 10:116390739-116390761 GAGGAGAAGGAGGAGGAAGAAGG + Intergenic
1074746180 10:116534837-116534859 GGGTAGAAGGAGGGTGAGGATGG - Intergenic
1074773772 10:116751071-116751093 AGGAAGAAGGAGGAGGAGGAGGG + Intergenic
1075136194 10:119788333-119788355 TTCTAGATGGAGCATGAAGACGG + Intronic
1075352402 10:121735384-121735406 ATGCAGAAGAATGATGCAGAAGG + Intergenic
1075427288 10:122351619-122351641 AGGTGGAAGGAGGAAGAAAAGGG + Intergenic
1075759581 10:124845907-124845929 CTGGAGAATGAGGATGAGGATGG - Intergenic
1077998896 11:7476998-7477020 AAGAAGAAGGAAGAAGAAGAAGG + Intergenic
1077998916 11:7477080-7477102 AGGAAGGAGGAGGAGGAAGAGGG + Intergenic
1078113875 11:8425879-8425901 CTCTAGAGGGAGGATGCAGATGG + Intronic
1078143220 11:8706500-8706522 ATGAAGCAGGAGGAGGGAGATGG - Intronic
1078168227 11:8909423-8909445 AAGGAGGAGGAGGAGGAAGAAGG + Intronic
1078769469 11:14334929-14334951 ATGTTGATGGAGGAGAAAGAAGG - Intronic
1079182155 11:18203507-18203529 AAGTGGAAGGAGGAAGAAGAAGG + Intronic
1079429358 11:20374119-20374141 ATGGGAAAGGAGGATGAGGAAGG + Intronic
1079449560 11:20588044-20588066 AAGGAGAAGGAGGAAGAAGAGGG + Intergenic
1079666212 11:23109202-23109224 ATAGAGAAGGAGGTTGGAGATGG + Intergenic
1079810962 11:24999418-24999440 AAGGAGGAGGAGGAGGAAGAAGG + Intronic
1080147442 11:29004312-29004334 AAGGAGAAGGAGGAAGAAAAAGG - Intergenic
1080643361 11:34171155-34171177 GTGTAGAGTGAGGATGAGGATGG + Intronic
1080741692 11:35070620-35070642 ATTTAGAAAGAGGATCAAAAAGG + Intergenic
1080850825 11:36068409-36068431 CTGTAAAAGGAAGATAAAGATGG - Intronic
1080872366 11:36248096-36248118 AAGAAGGAGGAGGAGGAAGAGGG - Intergenic
1082673697 11:56069090-56069112 TTACAGAAGGAGGATGATGAAGG + Intergenic
1083105522 11:60354642-60354664 ATGGAAATGGAGGATGAAAAGGG + Intronic
1083153085 11:60805778-60805800 ATGGAGACGGAGAAGGAAGAGGG - Intergenic
1084050057 11:66593505-66593527 ATGAAGAAGGTGCTTGAAGAGGG + Intronic
1084474155 11:69379178-69379200 ATGTTGAGGGAAGATGAAAAGGG - Intergenic
1084571659 11:69963411-69963433 AAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1085618921 11:78022888-78022910 ATGTAGAGGGAGGAAGCAAAAGG + Intronic
1085684580 11:78610119-78610141 AAGGAGAAGGAGGAAGAAGAAGG - Intergenic
1085768145 11:79301799-79301821 CTGGAGCAGGAGGAAGAAGAGGG - Intronic
1086302505 11:85442885-85442907 AGGAAGAAGGAAGAAGAAGAAGG + Intronic
1086302509 11:85442919-85442941 AAGAAGAAGAAGGAGGAAGAAGG + Intronic
1086302510 11:85442922-85442944 AAGAAGAAGGAGGAAGAAGGAGG + Intronic
1086759950 11:90616208-90616230 ATGAAGAAGCAGCATGAACATGG - Intergenic
1086998927 11:93393024-93393046 AAGTAGAAGGAGGAGGAGGAGGG - Intronic
1087327279 11:96739032-96739054 CTGAAGAGGGAGGCTGAAGAGGG - Intergenic
1087564836 11:99841652-99841674 AAGGAGAAGGAGAATGAAGAAGG + Intronic
1087570349 11:99919432-99919454 ATGTAGTAGCTGAATGAAGAGGG - Intronic
1088070455 11:105777965-105777987 ATGTAGAAGAATGAAGAAGTAGG - Intronic
1088213060 11:107477393-107477415 CTGTAAAATGAGGATGATGATGG - Intergenic
1088568701 11:111199876-111199898 ATTTTGAAGGATGATAAAGAAGG - Intergenic
1089025273 11:115262882-115262904 TAGGAGAAGGTGGATGAAGAAGG - Intronic
1089531695 11:119134082-119134104 AGGTACAAGGAACATGAAGATGG + Exonic
1089690293 11:120182902-120182924 ATGTGGCAGGAGGAGGGAGAAGG + Intronic
1089746912 11:120623970-120623992 AGGGAGAGGGAGGAGGAAGAGGG - Intronic
1089949978 11:122516498-122516520 ATTTAGAAGGAGGTTGGAGAAGG - Intergenic
1090042697 11:123304556-123304578 ATGGAGGAGAAGGATGGAGAGGG + Intergenic
1090464628 11:126923293-126923315 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1090464632 11:126923319-126923341 AAGGAGAAGGAAGAAGAAGAAGG - Intronic
1090464635 11:126923344-126923366 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1090749997 11:129738163-129738185 ATCTGGAAGGAGCAGGAAGAAGG - Intergenic
1090961548 11:131561781-131561803 AAGAAGAAGGATGATGATGAAGG - Intronic
1091074184 11:132599370-132599392 AGGAAGAAGGAGGAAGAAGGAGG + Intronic
1091074186 11:132599380-132599402 AGGAAGAAGGAGGAAGAAGGAGG + Intronic
1091074188 11:132599390-132599412 AGGAAGAAGGAGGAAGAAGGAGG + Intronic
1091074190 11:132599400-132599422 AGGAAGAAGGAGGAAGAAGGAGG + Intronic
1091074192 11:132599410-132599432 AGGAAGAAGGAGGAAGAAGGTGG + Intronic
1091193321 11:133712165-133712187 AGGCAGGAGGAGGATGAAGCAGG + Intergenic
1091413506 12:259970-259992 ATGGAAAAGAAGGAGGAAGATGG - Exonic
1091603082 12:1929782-1929804 TAGGAGAAGGAGGAAGAAGAGGG + Intergenic
1091603157 12:1930007-1930029 AGGGAGGAGGAGGAAGAAGAGGG + Intergenic
1091842053 12:3628332-3628354 GTGGAGGAGGAGGAAGAAGAAGG + Intronic
1091884179 12:4003906-4003928 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1092307259 12:7314140-7314162 ATGTAGAAGATGAAGGAAGAAGG + Intronic
1092445131 12:8548561-8548583 ATGTAGAAGGATGACAAAGATGG - Intergenic
1092550217 12:9490302-9490324 AGGTGGAAGGAGAAGGAAGAAGG + Intergenic
1093084579 12:14852466-14852488 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
1093351530 12:18108567-18108589 AGATAAAAAGAGGATGAAGAAGG + Intronic
1093508396 12:19896752-19896774 AGGAAGAAGGAGGAAGAAGGAGG - Intergenic
1093508399 12:19896765-19896787 AGGAGGAAGGAGGAGGAAGAAGG - Intergenic
1093508408 12:19896805-19896827 AAGAAGAAGAAGGAAGAAGAAGG - Intergenic
1093813203 12:23511963-23511985 ATGAACAAGGAGGTTGAAGAAGG - Intergenic
1093830810 12:23755479-23755501 ATCTTGAAGGAGGATGTAGCAGG - Intronic
1094088138 12:26616818-26616840 ATTCAGGAGGAGGAGGAAGAGGG - Intronic
1094098063 12:26730328-26730350 GTTTAGAAGCAGGATGAGGAGGG - Intronic
1094129893 12:27063500-27063522 AAGAAGAAGGAGGAGGAGGAAGG - Intronic
1094521591 12:31196071-31196093 AGGTGGAAGGAGAAGGAAGAAGG - Intergenic
1094628261 12:32146923-32146945 AAGAAGAAGGAGGAGGAAGGAGG - Intronic
1094816668 12:34193375-34193397 ATGGAGAATGAGGAGAAAGAAGG + Intergenic
1095271700 12:40225887-40225909 TGGTAGAAGGAGGATAAAAATGG + Intronic
1095480005 12:42625010-42625032 AGGAAGAAGAAGGAAGAAGAAGG - Intergenic
1095537063 12:43261698-43261720 ATATACAAGGAGGAAGAGGAAGG + Intergenic
1096616944 12:52838646-52838668 AGGAAGAAGGAGGAACAAGAAGG + Intronic
1097409630 12:59235457-59235479 ATGGAGAGGTAGGGTGAAGAGGG - Intergenic
1097892241 12:64789161-64789183 AAGAAGAAGAAGGAAGAAGAAGG - Intronic
1098106035 12:67069517-67069539 AGGAAGAAGGAGGAGGAGGAGGG - Intergenic
1098726108 12:73969825-73969847 AGTAAGAAGGAGGAAGAAGAGGG + Intergenic
1099359290 12:81679560-81679582 ATGTAGAAGATGAATGAAAAGGG + Intronic
1099950044 12:89291825-89291847 CTGAAGAAGGAGAAAGAAGAGGG + Intergenic
1100438461 12:94593402-94593424 AAGAAGAAGGAAGAAGAAGAAGG + Intronic
1100438462 12:94593412-94593434 AAGAAGAAGAAGGAAGAAGAAGG + Intronic
1101794108 12:107957020-107957042 AGGAAGAAGAAGGAAGAAGAAGG - Intergenic
1102167892 12:110820835-110820857 ACGAAGAAGGAGGAGGAGGAGGG - Intergenic
1102194378 12:111014195-111014217 ATGAAGATGGAAGAAGAAGAGGG + Intergenic
1102230367 12:111257636-111257658 AGGAGGAAGGAGGAGGAAGAGGG - Intronic
1102243651 12:111341607-111341629 ATGCAGAAGGAGAGTGAGGAGGG + Intronic
1102452331 12:113051130-113051152 ATTTAGGATGAGGATTAAGAGGG - Intergenic
1102598747 12:114012894-114012916 AGGGAGAAGGAGGAGGGAGAGGG + Intergenic
1102899320 12:116624090-116624112 AAGGAGAAAGAGAATGAAGAAGG + Intergenic
1103525150 12:121562646-121562668 ATGGAGGAGGAGGAGGAGGAAGG + Intronic
1104275659 12:127325035-127325057 ATGAAGATGGAGGAGGAGGAAGG - Intergenic
1104820278 12:131673061-131673083 ATGAAGGAGGAGGAGGAGGAGGG + Intergenic
1105269081 13:18854080-18854102 CTGTAGAAGAAGGAAGAACAGGG - Intergenic
1105274122 13:18904907-18904929 ATGTAGAAGGAGGAAAGACAGGG - Intergenic
1105738331 13:23295705-23295727 AGGAAGAAGGAGGAGGAAGGAGG - Intronic
1106466186 13:30016428-30016450 ATGTCGAGGGTGGAAGAAGATGG - Intergenic
1107071427 13:36274041-36274063 ATAGAGAAGGAGAATGAAGTGGG - Intronic
1108192751 13:47959415-47959437 AGGGAGAAGGAGGAGGGAGAAGG + Intronic
1108372937 13:49788939-49788961 AATTTGAAGGAGGAGGAAGAGGG + Intronic
1108419893 13:50237945-50237967 ATGTAGAAAGGGGATGGGGAAGG + Intronic
1108775503 13:53761064-53761086 ATGTTGAAGGGGGAGGAAGGTGG + Intergenic
1109167937 13:59058960-59058982 ATGTAGAATGGGAATGAAGACGG + Intergenic
1109289800 13:60460005-60460027 ATGTAAAAGGAGGGAGAAGTGGG + Intronic
1109411638 13:61977876-61977898 ATGTAAAAGGAAGATGGAGGAGG + Intergenic
1109764414 13:66874974-66874996 ATGTAGAAGGGGGAGGGAGGAGG + Intronic
1109777344 13:67059008-67059030 ATGTAAGAAGAGGAAGAAGAGGG - Intronic
1110077444 13:71265423-71265445 AGGAAGAAGGAAGAAGAAGAAGG - Intergenic
1110081673 13:71321421-71321443 ATAAAGAAGGAGAAAGAAGATGG + Intergenic
1110484482 13:76022034-76022056 CTGTAGAAGGAGGAAGAAATTGG + Intergenic
1110698750 13:78522615-78522637 ATGAAAAAGGAGGATGTACAAGG + Intergenic
1110700383 13:78540620-78540642 AAGAAGAAGGAGGATGGGGAGGG - Intergenic
1111321919 13:86642747-86642769 AGGTAGAAGGTGGATAAAAAAGG - Intergenic
1112327618 13:98453112-98453134 AAAAAGGAGGAGGATGAAGAAGG + Exonic
1112404350 13:99105102-99105124 AAGAAGAAGGAAGATGAAGAGGG - Intergenic
1112842995 13:103602586-103602608 TTGTGGAAGGTGGATGAAAATGG + Intergenic
1113258605 13:108534769-108534791 AGAAAGAAGGAGGAAGAAGAAGG - Intergenic
1113672225 13:112183052-112183074 GTGGAGAAGGAGGCTGACGATGG - Intergenic
1113930724 13:113967600-113967622 ATGTAGGAGAAGGATGTAGGAGG + Intergenic
1114649761 14:24277057-24277079 ATGGAGAGTGAGGATGGAGAAGG + Intergenic
1114756664 14:25267779-25267801 TTGTTGCAGGAGGCTGAAGATGG + Intergenic
1115095383 14:29629943-29629965 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1115298130 14:31853447-31853469 ATGGAGAAGGTGGAGTAAGAAGG - Intronic
1115659133 14:35474601-35474623 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1115780043 14:36758947-36758969 ATGTCAAAGGAGGCTGCAGAGGG + Intronic
1116067640 14:40004344-40004366 ATAAAGAAGGAAGCTGAAGATGG - Intergenic
1116329101 14:43573843-43573865 CTGTGGAAGGAGGATGAATTGGG + Intergenic
1116475081 14:45330866-45330888 AAGGAGAAGGAGGAGGAAGAAGG - Intergenic
1116504934 14:45666155-45666177 ATGTAGAAGGTGGGGCAAGATGG - Intergenic
1117372761 14:55093967-55093989 AGGAAGAAGGAGGAGGAGGAGGG + Intergenic
1118105218 14:62650941-62650963 AGGCAGAAGGAGGAAGAAGATGG - Intergenic
1118349080 14:64960760-64960782 ATGTAGAAGGAGGCTTATGTTGG + Intronic
1118499470 14:66345333-66345355 AGGTTGAAGAAGCATGAAGAAGG + Intergenic
1118588150 14:67376600-67376622 AGGTAGAAGGAGAGTCAAGAAGG - Intronic
1118886407 14:69870478-69870500 ATGTAGAAGGAGACTGCACAAGG - Intronic
1119186176 14:72644042-72644064 ATGGAAAATGAGGATGATGATGG + Intronic
1119359112 14:74033016-74033038 AGAAAGAAGGAGGATGAGGAAGG - Intronic
1119888215 14:78162260-78162282 CTGGAGAAGGAGGGTGCAGATGG + Intergenic
1120309459 14:82811186-82811208 ATGTAGAAGGAGGATATGGAGGG - Intergenic
1120511618 14:85422424-85422446 ATGTAGCATTAAGATGAAGAAGG - Intergenic
1120578650 14:86217756-86217778 ATGGAGGAGGAGGAGGAAGAAGG - Intergenic
1120719076 14:87870902-87870924 AAGAAGAAGAAGGAAGAAGAAGG - Intronic
1120719078 14:87870928-87870950 AGGAAGAAGGAAGAAGAAGATGG - Intronic
1120930298 14:89841576-89841598 AAGTACAAGGAGGATTAAGAGGG - Intronic
1120930739 14:89845761-89845783 AGGGAGAAGCAGGCTGAAGATGG + Intronic
1121777151 14:96598361-96598383 AGGGAGGAGGAGGAGGAAGACGG - Intergenic
1121831385 14:97055270-97055292 ATGAAGAAGGAGAAGAAAGAAGG - Intergenic
1121880853 14:97499256-97499278 ATTTAGAAGAAGAAGGAAGAAGG + Intergenic
1121905201 14:97734800-97734822 TGGAAGAAGGAGGAGGAAGAAGG - Intergenic
1121921282 14:97883839-97883861 ATTTAGAAGGTGGATCTAGAAGG - Intergenic
1122038161 14:98963298-98963320 AAGGAGAAGGAGAAAGAAGAAGG + Intergenic
1122314133 14:100815738-100815760 AGGTAGAGGGAGGAAGATGAGGG - Intergenic
1122685066 14:103500120-103500142 ATGTAGAAGCAGAGAGAAGAGGG - Intronic
1122916095 14:104859660-104859682 GTGGAGATGGAGGATGGAGATGG - Intergenic
1122916120 14:104859762-104859784 GTGGAGATGGAGGATGGAGATGG - Intergenic
1122916136 14:104859827-104859849 ATGGAGATGGAGGGTGGAGATGG - Intergenic
1122916200 14:104860122-104860144 ATGGAGATGGAGGATGGAGATGG - Intergenic
1202830226 14_GL000009v2_random:19908-19930 CTGTAGAAGAAGGAAGAACAGGG + Intergenic
1123800313 15:23811953-23811975 ATGAAGAAGGAGGAGGATGGTGG + Intergenic
1124459631 15:29877610-29877632 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
1125049735 15:35283047-35283069 AAGAAGAAGAAGGAAGAAGAAGG - Intronic
1125983923 15:44030710-44030732 AAGGTGAAGGAGGAGGAAGATGG + Intronic
1126052331 15:44697311-44697333 AAGGAGAAGAAGGAAGAAGAAGG - Intronic
1126297950 15:47162291-47162313 AGTTAGAAGGAGGATGAGCATGG + Intergenic
1126764161 15:51996690-51996712 AAGAAGAAGGAGGAGGAGGACGG - Intronic
1126881502 15:53103629-53103651 ATGAATGAGGAGGATGATGAAGG + Intergenic
1126961749 15:54004135-54004157 AGGTAGAAGGAAGATGCAGATGG - Intergenic
1127503176 15:59573577-59573599 ATGAACAAGGAAGAGGAAGAGGG + Intergenic
1128095618 15:64952324-64952346 AAGAAGAAGGAGAAGGAAGAAGG - Intronic
1128095631 15:64952461-64952483 AAGAAGAAGGAGAAGGAAGAAGG - Intronic
1128095670 15:64952813-64952835 AGGAAGAAGGAGGAGGAAGAAGG - Intronic
1128095718 15:64953419-64953441 AGGAAGGAGGAGGAAGAAGAAGG - Intronic
1128095821 15:64954599-64954621 AAGAGGAAGGAGGAGGAAGAAGG - Intronic
1128160521 15:65420746-65420768 CTGTAGAAGGAGAATGATGATGG - Intronic
1128856135 15:71018045-71018067 CTGTAAAAGGAGGAGGAGGAGGG + Intronic
1129108329 15:73323517-73323539 ATGTGGAAGGAGGATGAAGACGG + Exonic
1129303134 15:74638150-74638172 AGTTAGAAGGATGAAGAAGAAGG - Intronic
1129406398 15:75321828-75321850 AGGATGAAGGAGGAGGAAGAAGG - Intergenic
1129991724 15:79970875-79970897 ATGGAAAAGGAGTTTGAAGACGG - Exonic
1130128718 15:81117874-81117896 AAAGAGGAGGAGGATGAAGAAGG - Intronic
1131066390 15:89437263-89437285 AGGTAGAAGAAGGAGGAAGAGGG - Intergenic
1131077849 15:89507287-89507309 ACGGAGAAGGAGGAAGAGGAGGG - Intergenic
1131898894 15:97066160-97066182 AAATAGGAGGAGAATGAAGAGGG - Intergenic
1131901070 15:97088539-97088561 ATGAAGGAGGAGGAGGAGGAAGG - Intergenic
1132002815 15:98197032-98197054 ATATAGATAGAGTATGAAGAAGG - Intergenic
1132028049 15:98419586-98419608 ATGGAGGAGGAGGAGGAGGAGGG + Intergenic
1132160351 15:99535756-99535778 ATGTTGAATGTGGATGAAAAAGG + Intergenic
1133442108 16:5829560-5829582 ATGTTGGAGGAGGTAGAAGAGGG - Intergenic
1133580716 16:7141991-7142013 AAGAAGAAGGAGGAAGAAGAAGG - Intronic
1133917127 16:10119215-10119237 ATTCAGTAGGAGGAGGAAGATGG + Intronic
1134449392 16:14354212-14354234 AGGTAGAGGGAGGAGGAGGAAGG + Intergenic
1135118133 16:19740988-19741010 ATCTACAAGCAGGATGAAGCAGG + Intronic
1135983747 16:27168572-27168594 AAGATGAAGGAGGATGGAGAAGG + Intergenic
1136539093 16:30918682-30918704 AAGGAGAAGAAGGAAGAAGAAGG - Intergenic
1136539112 16:30918766-30918788 AAGAAGAAGGAAGAAGAAGAGGG - Intergenic
1136998966 16:35212350-35212372 ATGTATCAGATGGATGAAGATGG + Intergenic
1137290916 16:47051350-47051372 ACGATGAAGGAGGATGAGGAAGG + Intergenic
1137556975 16:49477040-49477062 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1137622776 16:49887214-49887236 AAGTAGAAGGACGAGGAAGAGGG - Intergenic
1138126165 16:54440468-54440490 ATGGAGGAGGAGGAGGAAGGAGG - Intergenic
1138541608 16:57691080-57691102 AAGGAGGAGGAGGAGGAAGAAGG + Intergenic
1138541623 16:57691135-57691157 AAGGAGGAGGAGGAGGAAGAAGG + Intergenic
1138938410 16:61759432-61759454 CAGTAGTAGGAGGAGGAAGAGGG + Intronic
1139121746 16:64027087-64027109 ATGTGGTTGGAGCATGAAGAGGG - Intergenic
1140266419 16:73425165-73425187 CTGTAGCAGGAGGGTGGAGAGGG + Intergenic
1140756344 16:78070996-78071018 ATATAGTAGGAAGATGAGGATGG - Intergenic
1140761598 16:78113825-78113847 AAATAGAATGAGGATGAGGATGG + Intronic
1140965727 16:79964259-79964281 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1141003963 16:80334985-80335007 CTTTAGGAGCAGGATGAAGATGG - Intergenic
1141514594 16:84535193-84535215 AAGGAGAAGGAGGAAGAGGAGGG - Intronic
1141640494 16:85338181-85338203 ATGAGAAAGGAGGATGAAGCAGG - Intergenic
1141840622 16:86571966-86571988 AGGTGGAAGGAGGTTGAGGATGG + Intergenic
1141845127 16:86603409-86603431 CAGTAGGAGGAAGATGAAGAAGG - Intergenic
1141845138 16:86603466-86603488 CAGTAGGAGGAAGATGAAGAAGG - Intergenic
1141845171 16:86603637-86603659 CAGTAGGAGGAAGATGAAGAAGG - Intergenic
1142958160 17:3535190-3535212 AGGGAGAAGGAGGAGGGAGAGGG - Intronic
1143035131 17:3990770-3990792 AAGGAGTAGGAGGAAGAAGAAGG - Intergenic
1143391364 17:6561092-6561114 AAGGAGAAGGAGGAAGAGGAAGG - Intergenic
1143391506 17:6561578-6561600 AGGGAGAAGGAGGAAGAGGAGGG - Intergenic
1143395409 17:6590998-6591020 AGGAAGAAGAAGGAAGAAGAAGG + Intronic
1143622178 17:8087009-8087031 ATGAAGGAGCAGGATGGAGAAGG + Intronic
1143794681 17:9327172-9327194 AAGAAGAAGAAGGAAGAAGAAGG + Intronic
1143794686 17:9327199-9327221 AGGAAGAAGGAGGAAGAAGGAGG + Intronic
1143794688 17:9327209-9327231 AGGAAGAAGGAGGAAGAAGGAGG + Intronic
1143993124 17:10983975-10983997 CTGTAGAAGTTGGAAGAAGAGGG - Intergenic
1143997559 17:11020710-11020732 ATTTAGAAGGAAGATTGAGATGG + Intergenic
1144171536 17:12664126-12664148 ATGTAGAAGAGGGAAGCAGAAGG + Intergenic
1144237203 17:13273014-13273036 ATGAATATGGAGGATCAAGATGG - Intergenic
1144626075 17:16845080-16845102 ATGAGGCAGGAGGATGCAGATGG - Intergenic
1144646145 17:16974904-16974926 AAGGAGGAGGAGGAAGAAGAAGG + Intergenic
1144746787 17:17621370-17621392 AAGAAGAAGGAGGAAGAAGAAGG + Intergenic
1144746790 17:17621396-17621418 AAGAAGAAAGAGGAAGAAGAAGG + Intergenic
1144880358 17:18427640-18427662 ATGAGGCAGGAGGATGCAGATGG + Intergenic
1145151877 17:20516747-20516769 ATGAGGCAGGAGGATGCAGATGG - Intergenic
1145965531 17:28914049-28914071 AGATAGAAGGAGGAAGGAGAGGG + Intronic
1146315038 17:31800166-31800188 ATGAAGACAGAGGAAGAAGATGG - Intergenic
1146448763 17:32954887-32954909 ATGTAAAAGGAGGGTGATGAGGG - Intergenic
1146789555 17:35743591-35743613 GTGTGGAAGGAGGGTGAAGGTGG + Intronic
1147178563 17:38671554-38671576 TTGTGGGAGGAGGAGGAAGAAGG - Intergenic
1147580222 17:41623777-41623799 ATGAGGCAGGAGGATGCAGATGG - Intronic
1147800696 17:43084616-43084638 GTGTAGCAGGAGAAAGAAGATGG - Intronic
1148459880 17:47833370-47833392 AGGAAGAAGGAGGAGGAAGAAGG - Intronic
1148464372 17:47856231-47856253 ATGTAAAAAGAGGATGAAAAGGG - Intergenic
1148488097 17:48004153-48004175 GCGGAGAAGGAGGAAGAAGACGG - Intergenic
1148987587 17:51637113-51637135 AGGAAGAAGGATCATGAAGAGGG - Intronic
1149292135 17:55227546-55227568 ATGTGGAAGGAGGTCGAAGGAGG + Intergenic
1149612591 17:57968414-57968436 ATGTATATGGAGGAAGAAAAAGG - Intergenic
1149978691 17:61291914-61291936 ATGTAGGGTGAGGAGGAAGAGGG + Intronic
1150915979 17:69437384-69437406 AAGGAGGAGGAGGAAGAAGAGGG + Intronic
1151158542 17:72145040-72145062 AAGTAGGAGGAGGAGAAAGAAGG - Intergenic
1151345742 17:73500275-73500297 AGATGGAAGGAGGATGGAGAAGG - Intronic
1152336703 17:79703054-79703076 GAGTAGGAGGAGGAAGAAGAGGG - Intergenic
1152428451 17:80232761-80232783 AGGTAGAAGGAGGGGGAAAAGGG - Intronic
1152508404 17:80768988-80769010 AAGTAAAATGAGGATGAAAATGG - Intronic
1152913115 17:83016733-83016755 GGGAAGAAGGAGGATGAAGGTGG + Intronic
1152933471 17:83122417-83122439 ATGCAGAAGGAAGAGGAAGGAGG + Intergenic
1152982742 18:294262-294284 AAAGAGAATGAGGATGAAGAGGG - Intergenic
1153185255 18:2478918-2478940 AGGAAGAAGGAGGAGGAGGAGGG + Intergenic
1153381864 18:4449229-4449251 AAGAAGGAGGAGGAAGAAGAGGG + Intronic
1153557725 18:6333617-6333639 ATGGAGAAGCAGGATGCAGGTGG + Intronic
1153638048 18:7129904-7129926 ATGTGGAGCGAGAATGAAGAAGG + Intergenic
1153955253 18:10090645-10090667 AAGGAGAAGGAAGAAGAAGAGGG - Intergenic
1154056329 18:11016058-11016080 ATGGAGAAGGAGGAAGAATGAGG - Intronic
1154426072 18:14273023-14273045 ATGTAGAAGCAGGTTCAAAAGGG + Intergenic
1154465825 18:14642159-14642181 ATGTAGAAGGAGGAAAGAGAGGG - Intergenic
1155066517 18:22273718-22273740 ATGGAGGAGGAGGAGGAGGAGGG - Intergenic
1155482420 18:26303422-26303444 AAGTAGAGGGAGGATGAAAGTGG - Intronic
1155985630 18:32227813-32227835 AGGAAGGAGGAGGATGAAGAGGG + Intronic
1156598846 18:38579821-38579843 AAGGAGAAGGAGGAGGTAGAAGG + Intergenic
1156846482 18:41671541-41671563 GTGGAGAAGGAGGAAGAAGAGGG + Intergenic
1157214684 18:45773115-45773137 AAGAAGAAGAAGGAAGAAGAAGG - Intergenic
1157442843 18:47723512-47723534 ATGGAGAAGGAGGATGGAGCTGG - Intergenic
1157768664 18:50325135-50325157 AAGGAGAAGGAGGAGGAAGGAGG - Intergenic
1157768670 18:50325161-50325183 AAGAAGAAGAAGGAAGAAGAAGG - Intergenic
1158737391 18:60098789-60098811 AAGAGGAAGGAGGAGGAAGAAGG - Intergenic
1159266127 18:66082048-66082070 ATGCAGAGGGAGGATGTAGTAGG - Intergenic
1159360830 18:67400425-67400447 AGGTAGCAGCAGGATGATGAGGG - Intergenic
1159591007 18:70335046-70335068 AAGAAGAAGAAAGATGAAGAAGG - Intergenic
1159797543 18:72863186-72863208 ATACAGCAGGAGGCTGAAGAGGG - Intronic
1159880986 18:73858336-73858358 TTGGAGAAGGAGGCAGAAGATGG - Intergenic
1159930733 18:74310685-74310707 ATGTAGATGGACGATGTAGTTGG - Intergenic
1160007179 18:75076037-75076059 AGGGAGGAGGAGGAGGAAGAGGG + Intergenic
1160071593 18:75633733-75633755 ATGTCCAAGGAGGATGAATTTGG + Intergenic
1160676393 19:393622-393644 ATGGGGAAGGATGATGGAGAAGG + Intergenic
1160676438 19:393799-393821 ATGGGGAAGGATGATGGAGAAGG + Intergenic
1160676460 19:393912-393934 ATGGAGAAGGATGATGGAGAAGG + Intergenic
1160676476 19:393967-393989 ATGGGGAAGGATGATGGAGAAGG + Intergenic
1160676615 19:394562-394584 ATGGGGAAGGATGATGGAGAAGG + Intergenic
1160676619 19:394575-394597 ATGGAGAAGGATGATGGGGAAGG + Intergenic
1160676710 19:394993-395015 ATGGAGAAGGATGACGGAGAAGG + Intergenic
1160676728 19:395069-395091 ATGGGGAAGGATGATGGAGAAGG + Intergenic
1160676758 19:395194-395216 ATGGAGAAGGATGATGGGGAAGG + Intergenic
1160676783 19:395294-395316 ATGGAGAAGGATGATGGGGAAGG + Intergenic
1160676808 19:395394-395416 ATGGAGAAGGATGATGGGGAAGG + Intergenic
1160676883 19:395700-395722 ATGGAGAAGGGTGATGGAGAAGG + Intergenic
1160695196 19:480499-480521 ATGGAGAAGGATGATGGGGAAGG + Intergenic
1160695208 19:480564-480586 ATGGAGAACGATGATGGAGAAGG + Intergenic
1160695228 19:480651-480673 ATGGAGAAGGATGATGGAGAAGG + Intergenic
1160695232 19:480690-480712 ATGGAGAACGATGATGGAGAAGG + Intergenic
1160695243 19:480779-480801 ATGGAGAATGATGATGCAGAAGG + Intergenic
1160695259 19:480880-480902 ATGGAGAACGATGATGGAGAAGG + Intergenic
1160695299 19:481095-481117 ATGGAGAACGATGATGGAGAAGG + Intergenic
1160695345 19:481307-481329 ATGGAGAACGATGATGGAGAAGG + Intergenic
1160695347 19:481320-481342 ATGGAGAAGGATGATGGAGAAGG + Intergenic
1160695353 19:481358-481380 ATGGAGAACGATGATGGAGAAGG + Intergenic
1160695369 19:481421-481443 ATGGAGAAGGATGATGGGGAAGG + Intergenic
1160925352 19:1542229-1542251 AGGGAGAAGAAGGAAGAAGAAGG - Intergenic
1160941388 19:1621909-1621931 GAGGAGAAGGAGGATGCAGATGG + Exonic
1161027993 19:2045515-2045537 GAGGAGAAGGAGGAAGAAGAGGG - Intronic
1161509580 19:4663070-4663092 CTGTAGAATGAGGATGGAGTGGG - Intronic
1161509589 19:4663113-4663135 CTGTAGAATGAGGATGAGGTGGG - Intronic
1161509719 19:4663640-4663662 CTGTAGAATGAGGATGAGGTGGG - Intronic
1161635117 19:5383652-5383674 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1161934343 19:7362297-7362319 AAGGAGAAGGAGGAAGAAGAAGG + Intronic
1163260283 19:16185542-16185564 AGGTCTAAGGGGGATGAAGACGG - Intronic
1163387259 19:17007459-17007481 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
1164292696 19:23881842-23881864 GAGGAGAAGGAGGAGGAAGAGGG + Intergenic
1164322606 19:24163396-24163418 ATGTAGGATGAGGCTTAAGATGG + Intergenic
1164591879 19:29511931-29511953 AAGGAGAGGGAGGATGAGGAAGG + Intergenic
1164592134 19:29512906-29512928 TTGGAGAAGGAGGAAGGAGAGGG + Intergenic
1164634263 19:29781125-29781147 TTCTGGAAGAAGGATGAAGAGGG - Intergenic
1164718639 19:30415046-30415068 AAGCAGAAGCAGGAAGAAGAAGG - Intronic
1165416072 19:35694257-35694279 AAGGAGGAGGAGGAGGAAGAAGG - Intergenic
1165468770 19:35990829-35990851 AGGAAGAAGGAGGAAGAAGGAGG + Intergenic
1165468772 19:35990839-35990861 AGGAAGAAGGAGGAAGAAGGAGG + Intergenic
1165468774 19:35990849-35990871 AGGAAGAAGGAGGAAGAAGGAGG + Intergenic
1165468776 19:35990859-35990881 AGGAAGAAGGAGGAAGAAGGAGG + Intergenic
1165468777 19:35990869-35990891 AGGAAGAAGGAGGAAGAAGAAGG + Intergenic
1165925645 19:39324531-39324553 GAGGAGAAGGAGGAGGAAGAAGG + Intergenic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166177223 19:41082708-41082730 ATGTAGAAAGGTGATCAAGATGG - Intergenic
1166719234 19:44987971-44987993 CTGTAGAGGGAGGCTGAAGGTGG - Intronic
1166937088 19:46340449-46340471 AGGAAGAAGGAAGAAGAAGAAGG - Exonic
1167433060 19:49464307-49464329 AGGGAGAAGGGAGATGAAGATGG - Intronic
1167608262 19:50493215-50493237 AGGTAGAAGGAGAATGGGGAGGG + Intergenic
1202642465 1_KI270706v1_random:107864-107886 CTGTAGAAGAAGGAAGAACAGGG - Intergenic
925702126 2:6649227-6649249 ATGAAGAATGAGGAGGAAGAAGG - Intergenic
925879180 2:8336959-8336981 ATTTAGACAGAGGATGAAAAAGG + Intergenic
927710812 2:25324746-25324768 ATGGATAAGGAGGAGGGAGAGGG + Intronic
928171798 2:29009212-29009234 ATGGAGATGGAGGTGGAAGAGGG + Intronic
928215071 2:29354555-29354577 ATTGAGAAGAAGGATGAAGAAGG - Intronic
928316664 2:30251828-30251850 ATTTAGTATGAGGATGATGAAGG + Intronic
928815091 2:35284312-35284334 ATCTTGAAGGAGGAGGAATAAGG + Intergenic
929015015 2:37485260-37485282 AAGAAGAAGGAGGAAGAAGAAGG - Intergenic
929651673 2:43686151-43686173 AGGAAGAAGGAAGAGGAAGAAGG - Intronic
929766434 2:44847819-44847841 AAGAAGAAAGAGGAGGAAGAAGG - Intergenic
929910954 2:46089185-46089207 ATGTAGAATAAGAATGAGGAGGG - Intronic
930317394 2:49814295-49814317 AAGAAGGAGGAGGATAAAGAGGG + Intergenic
930364680 2:50424289-50424311 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
930422688 2:51174541-51174563 AAGGAGAAGGAGGATAAAGTTGG + Intergenic
930624306 2:53679469-53679491 ATGGAGAAGAAAGATGAGGATGG - Intronic
930818534 2:55622463-55622485 AGGCAGAAGCAGGATGAAAAGGG - Intergenic
931289867 2:60862932-60862954 ATATAGAAGGATGAAAAAGAAGG - Intergenic
931566575 2:63621185-63621207 ATGTAGAAGGTGGCTTCAGACGG + Intronic
932208161 2:69902285-69902307 AGGAAGAAGGAGGAGGAAGGAGG - Intronic
932208165 2:69902298-69902320 AAGGAGGAGGAGGAGGAAGAAGG - Intronic
932460755 2:71880435-71880457 ATGTAGAGGGAGCATGAGGAAGG - Intergenic
932889285 2:75577928-75577950 AGGTAGAAGGTGAATGAAGTTGG + Intergenic
933084495 2:78038751-78038773 AAGTAGGAGGAGGAAGAAAAGGG - Intergenic
933505830 2:83176129-83176151 TTGGATAAGGAGGAGGAAGAGGG - Intergenic
933805370 2:85995149-85995171 GGGCACAAGGAGGATGAAGAGGG + Intergenic
934498305 2:94831304-94831326 CTGTAGAAGAAGGAAGAACATGG - Intergenic
934695830 2:96399630-96399652 AGGCAGAAGGAGGATGCAGGAGG - Intergenic
934882071 2:97991928-97991950 AATTAGAAGGAGGAGGAAAATGG + Intronic
936061950 2:109300650-109300672 ATGGAGAAGGAAGAGGAAGATGG - Intronic
936272489 2:111059927-111059949 GAGAAGAAGGAGGAGGAAGAGGG + Intronic
936731293 2:115384447-115384469 AAGAAGAAGAAGGAAGAAGAAGG + Intronic
936731294 2:115384457-115384479 AGGAAGAAGAAGGAAGAAGAAGG + Intronic
936922195 2:117700215-117700237 ATGTGGAAGAAGGAGGTAGAAGG + Intergenic
937140040 2:119592125-119592147 ATGTACAAAGAGGAGAAAGAGGG + Intronic
937217302 2:120321079-120321101 AGGGAGAAGGAGGAGGGAGAAGG - Intergenic
937217306 2:120321092-120321114 AGGGAGAAGGAGGAGGGAGAAGG - Intergenic
937217315 2:120321121-120321143 AGGGAGAAGGAGGAGGGAGAAGG - Intergenic
937490877 2:122365941-122365963 AGGCAGAAGGAGAAAGAAGAAGG + Intergenic
937609741 2:123846420-123846442 GACTAGAAGGAGGATGGAGAGGG + Intergenic
939020076 2:136948038-136948060 GTTTACAAGGAAGATGAAGATGG - Intronic
940011534 2:149060019-149060041 AGGGAGAAGGAGGAGGAGGAGGG + Intronic
940363232 2:152818081-152818103 ATGTAAGAGGAGGATGGGGAGGG + Intergenic
941143243 2:161811611-161811633 ATGTTGGAGAATGATGAAGAAGG - Intronic
941145767 2:161843052-161843074 ATGTAGTATGAGGGTAAAGAAGG - Intronic
941779489 2:169428502-169428524 ATGTAGAAAGATGCTGAAAATGG + Intergenic
941809250 2:169739032-169739054 AAGGAGGAGGAGGAAGAAGAAGG - Intronic
942496027 2:176541046-176541068 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
942815458 2:180048190-180048212 ATGTAGAAGAATGATGAAACTGG + Intergenic
943164715 2:184306340-184306362 GGGTAGGAGGAGGATGAGGATGG - Intergenic
943218704 2:185075782-185075804 ATGTAGAATGAGGAGGAGGAGGG + Intergenic
943291314 2:186075562-186075584 AAGGAGAAGGAGGAAGAGGAGGG - Intergenic
944064703 2:195606631-195606653 ATGGAGAAGCAGGAACAAGAAGG + Intronic
944113396 2:196160200-196160222 ATGCAGAAGGGGAATGCAGAAGG - Intronic
944269487 2:197765176-197765198 AGGGAGAAGGAGTAGGAAGAGGG + Intronic
945869053 2:215207166-215207188 GTGTAGAAGGAGATTAAAGATGG - Intergenic
946051630 2:216867603-216867625 AAGGAGAAGGAAGAGGAAGAGGG - Intergenic
946740106 2:222792868-222792890 GTGAAGAAGGAGGAGGAGGAGGG - Intergenic
947723848 2:232385056-232385078 AAGAAGAAGGAAGAAGAAGAAGG + Intergenic
948091753 2:235301626-235301648 AGGTGGAAGGAGGAAGAAGGAGG - Intergenic
948091867 2:235301991-235302013 AGGAGGCAGGAGGATGAAGAGGG - Intergenic
948458535 2:238118367-238118389 ATGGAGGAGGTGGATGGAGAAGG + Intronic
948458588 2:238118571-238118593 ATGGAGGAGGTGGATGGAGAAGG + Intronic
948458848 2:238119540-238119562 ATGGAGGAGGTGGATGAAGGAGG + Intronic
948485572 2:238278810-238278832 ATGTACAAGTGGGATGGAGAGGG + Intronic
948702479 2:239768909-239768931 AGGTAAAGGGAGGGTGAAGATGG - Intronic
949000942 2:241612788-241612810 ACGTAGAAGGCGCATGAGGAGGG + Intronic
1169797341 20:9477769-9477791 ATATAGAAGTAAGAAGAAGAAGG + Intronic
1170321950 20:15109993-15110015 ATGTACAAGGAACATGATGATGG + Intronic
1171889568 20:30698047-30698069 CTGTAGAAGAAGGAAGAACAGGG - Intergenic
1171941129 20:31330955-31330977 AAGGAGAAGGAGAAGGAAGAAGG + Intergenic
1171941130 20:31330968-31330990 AGGAAGAAGGAAGAAGAAGAAGG + Intergenic
1172060702 20:32185413-32185435 ATGTGAAAGGAGGTGGAAGAAGG + Intergenic
1172395152 20:34598115-34598137 GTGTAGAAGGAGGACGTACAGGG + Intronic
1172784043 20:37454288-37454310 AGGTTAATGGAGGATGAAGAGGG - Intergenic
1172834665 20:37865291-37865313 AGGTACAAGGGGAATGAAGACGG + Intronic
1172951888 20:38727569-38727591 CTGTACGAGGAGAATGAAGACGG + Exonic
1173056688 20:39621478-39621500 AAGAAGAAGGAGGAGGAAGAGGG - Intergenic
1173620163 20:44430338-44430360 CTGAAGAAGGAGGATGAGGTTGG - Exonic
1173710544 20:45151806-45151828 GCCTAGAAGGAGGATGAAGCTGG + Intergenic
1173791620 20:45831644-45831666 AAGAAGCAGGAGGAGGAAGAAGG + Intronic
1173943873 20:46934554-46934576 ATGTGGAGGGAGGGTGAAGCGGG + Intronic
1174011660 20:47454639-47454661 AAGAAGAAGAAGGAAGAAGAAGG - Intergenic
1174166104 20:48584589-48584611 AGGAAGAAGGAAGAAGAAGAAGG - Intergenic
1174880407 20:54273360-54273382 ATGTAGGACAAGGATTAAGAGGG - Intergenic
1175100631 20:56576269-56576291 TAGAAGAAGGAGGAGGAAGAAGG - Intergenic
1175438637 20:58974000-58974022 AAGAAGAAGAAGGAAGAAGAAGG + Intergenic
1175616641 20:60405365-60405387 ATGGAGAAGGGGGAAGGAGAAGG + Intergenic
1176609413 21:8864746-8864768 CTGTAGAAGAAGGAAGAACAGGG + Intergenic
1176720411 21:10388120-10388142 AAGGAGGAGGAGGAGGAAGAAGG + Intergenic
1176796653 21:13374991-13375013 AGGTAGATGGAGGAAGAAAAAGG + Intergenic
1176808762 21:13516435-13516457 ATGTAGAAGGAGGAAAGAGAGGG + Intergenic
1176854359 21:13953375-13953397 CTGTAGAAGAAGGAAGAACAGGG - Intergenic
1177376887 21:20281924-20281946 AAATAGAAGGAGGGTGAAAAAGG + Intergenic
1177507233 21:22034756-22034778 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1177587141 21:23111456-23111478 ATCTGGAAGGAGGAAGAATAGGG + Intergenic
1178225849 21:30717538-30717560 AAGTAGAAGGAGGAGGAGAAGGG + Intergenic
1178336189 21:31745585-31745607 ATGGAGAAAGAGGAAGTAGAAGG + Intergenic
1178643204 21:34363351-34363373 AGGAAGAAGAAGGAAGAAGAAGG - Intergenic
1178643205 21:34363361-34363383 AGGAAGAAGAAGGAAGAAGAAGG - Intergenic
1178643206 21:34363371-34363393 AGGAAGAAGAAGGAAGAAGAAGG - Intergenic
1178881747 21:36455451-36455473 CTGTGGAAGGAGGGTGAGGATGG + Intergenic
1179071241 21:38073088-38073110 AAGAAGAAGGAAGAAGAAGAAGG + Intronic
1179081804 21:38178535-38178557 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
1179191978 21:39131067-39131089 ATGGAGAAGGGGGAAGAACATGG + Intergenic
1180164307 21:46014006-46014028 ATGTATAAGGAGTATAGAGATGG + Intergenic
1180359507 22:11874592-11874614 CTGTAGAAGAAGGAAGAACAGGG + Intergenic
1180725022 22:17940413-17940435 AGGAAGGAGGAGGAGGAAGAAGG + Intronic
1181037382 22:20176426-20176448 ATGTGGAGGGAGAAGGAAGAAGG - Intergenic
1181344148 22:22205345-22205367 ATTTAAAAGGAGTATTAAGACGG - Intergenic
1181508458 22:23377637-23377659 ATGAAGAAGGAAGAGAAAGAAGG + Intergenic
1181538078 22:23557135-23557157 ATGCAGAAGGAGTTTCAAGAAGG + Intergenic
1181819198 22:25462563-25462585 ACGCAGAAGGGGGAGGAAGAGGG - Intergenic
1181856998 22:25789075-25789097 AAGAAGGAGGAGGAAGAAGAAGG - Intronic
1181860334 22:25813133-25813155 AGGAAGAAGGAGGAGGAGGAGGG - Intronic
1181977198 22:26738428-26738450 AAGGAGGAGGAGGAGGAAGAGGG - Intergenic
1182755881 22:32678546-32678568 AAGGAGGAGGAGGATGAAGGAGG - Intronic
1182931479 22:34178311-34178333 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1183016587 22:34993269-34993291 GAGTAGAAAGAGGAAGAAGAGGG + Intergenic
1183957306 22:41388645-41388667 ATGTAAAAGGAGGAGGAATAAGG - Intronic
1184345969 22:43913155-43913177 AAGAAGAAGAAGGAAGAAGAAGG - Intergenic
1184345971 22:43913229-43913251 AGGAAGAAGAAGGAAGAAGAAGG - Intergenic
1184345972 22:43913239-43913261 AAGAAGAAGAAGGAAGAAGAAGG - Intergenic
1184928400 22:47660741-47660763 ATGAAGAAGGAGGAAGAGGAGGG - Intergenic
1184952454 22:47853645-47853667 AGGAAGAAGAAGGAAGAAGAAGG + Intergenic
1184959363 22:47917900-47917922 AAGGAGAAGGAGGAAGGAGAGGG - Intergenic
1184989886 22:48160220-48160242 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
949096556 3:93454-93476 GTATACCAGGAGGATGAAGAAGG - Intergenic
949234394 3:1791043-1791065 AATTAGATGGAGGTTGAAGATGG + Intergenic
949246273 3:1928363-1928385 AGGGAGAAAGAGGATGAATAGGG + Intergenic
949250082 3:1973143-1973165 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
949424571 3:3902953-3902975 ATATAAAATGAGGATCAAGATGG - Intronic
949802501 3:7918969-7918991 ATGTAGGTGTGGGATGAAGAAGG + Intergenic
949828793 3:8191640-8191662 AAGAAGAAGAAGGAAGAAGAAGG - Intergenic
949976874 3:9468758-9468780 ATGTAGATGGAGGAAAATGAAGG + Intronic
949994758 3:9607925-9607947 AAGGAGGAGGAGGAAGAAGAAGG - Intergenic
950284494 3:11733970-11733992 ATGGAGAAAGAGCATGGAGAAGG + Intergenic
951402800 3:22254965-22254987 ATGTCCCAGGAGGATGAAGCAGG + Intronic
951964971 3:28371947-28371969 AAGAAGAAGGAAGAAGAAGAAGG - Intronic
952651271 3:35729462-35729484 AAGTGGAAGGAGGATGTAGCTGG - Exonic
952700094 3:36318536-36318558 ATGGAGGAGGAGGAGGAGGAAGG - Intergenic
953296529 3:41723375-41723397 AGGAAGAAAGAGGATAAAGAAGG - Intronic
954130579 3:48558715-48558737 CTGCAAAAGGAGGATGAGGAAGG - Intronic
954581042 3:51703106-51703128 AAGTACGAGGAGGATGGAGAAGG - Intronic
954813464 3:53262397-53262419 AAGGAGGAGGAGGAGGAAGAGGG - Intergenic
955208630 3:56920066-56920088 ATGTTGGATGAGTATGAAGAAGG - Intronic
955941492 3:64150539-64150561 GAGAAGAAGGAGGAGGAAGAAGG - Intronic
956235887 3:67070402-67070424 ACATAGAAAGAGGATGTAGATGG - Intergenic
957192623 3:77029351-77029373 ATGTAGAAGAAAAATGATGAGGG + Intronic
957261392 3:77906519-77906541 ATGGAGAAGGAGGCTGAAGAAGG + Intergenic
958858819 3:99420282-99420304 ATGTAAAATGAAGATGAAGGGGG - Intergenic
958871969 3:99570318-99570340 TTGTAGAGGGTGGATGAGGAAGG + Intergenic
959239768 3:103775509-103775531 AGGAAGAAGGAGGATGTAGAAGG - Intergenic
959365312 3:105450954-105450976 ATGTAGAGGGAGAATTAGGATGG + Intronic
959369376 3:105504463-105504485 AGCCAGAAGGAGGATGAAGTGGG + Intronic
959686218 3:109149909-109149931 TTAAAGCAGGAGGATGAAGATGG + Intergenic
959977310 3:112475084-112475106 ATTTAGAAGGAAGATAATGATGG + Intronic
960427825 3:117530790-117530812 AAGGAGAAGAAAGATGAAGAGGG - Intergenic
960456780 3:117882198-117882220 ATGGAGAAGTAGGATAAACAAGG - Intergenic
961018719 3:123486434-123486456 GTGTTGGAGAAGGATGAAGATGG - Intergenic
961474774 3:127139883-127139905 ATTAAGAAAGAGGATCAAGAGGG - Intergenic
962207556 3:133447478-133447500 AGGTAGAAGGTGGATGATGCAGG - Intronic
962566027 3:136661039-136661061 ATGTATAACAAGGATGAAAAAGG + Intronic
962914671 3:139888981-139889003 ATGTAGATAAATGATGAAGAAGG - Intergenic
963625438 3:147666175-147666197 AAGTAGAAGCAAGATAAAGAAGG - Intergenic
964159254 3:153626811-153626833 TTGTAGAAGGGGGATGGAAAAGG + Intergenic
964374401 3:156035408-156035430 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
965130982 3:164701230-164701252 ATTTAGAAAGAGGGGGAAGAGGG + Intergenic
965711734 3:171562693-171562715 AGGAAGAAGAAGGAAGAAGAAGG - Intergenic
965711735 3:171562703-171562725 AGGAAGAAGAAGGAAGAAGAAGG - Intergenic
965711736 3:171562713-171562735 AAGAAGAAGAAGGAAGAAGAAGG - Intergenic
965888840 3:173484607-173484629 CTCTAAAAGGAGAATGAAGATGG + Intronic
965980155 3:174680759-174680781 AAGGAGAAGGAGGAGCAAGATGG + Intronic
966315738 3:178643790-178643812 ATGTAGATTGAGGAAGAAGAAGG - Intronic
966521896 3:180882302-180882324 AAGAAGACGGAGGAAGAAGAAGG - Intronic
966559164 3:181299961-181299983 AAGGAGAAGGAGGAGGAGGAGGG + Intergenic
966612904 3:181885984-181886006 ATGTAAAAAGAGGAAGAACAGGG + Intergenic
966906551 3:184530364-184530386 TTGTAGGGGGAGGAGGAAGATGG + Intronic
967750448 3:193108930-193108952 ATCAAGAGGGAAGATGAAGAAGG - Intergenic
967761293 3:193228728-193228750 ACCTAGAAGGAGCATGCAGACGG - Intergenic
967987684 3:195107510-195107532 AAGAAGAAGGAGGAGGAAGGAGG + Intronic
968161611 3:196431962-196431984 ATGATGAAGGAGGAGGAGGAGGG + Intronic
968764206 4:2459614-2459636 ATGGAGCAGGAGGTTGAGGAGGG + Intronic
969737765 4:9002397-9002419 ATGTAAAAGAGGGATGTAGAGGG - Intergenic
970166861 4:13247755-13247777 AAGTAGAAGGAGAAAGAAGATGG - Intergenic
970814174 4:20134338-20134360 GAGAAGAAGGAGGAAGAAGAAGG + Intergenic
970814186 4:20134408-20134430 GAGAAGAAGGAGGAAGAAGAAGG + Intergenic
971146002 4:23976972-23976994 AGGAAGAAGGAGGAGGAAGAGGG + Intergenic
971406489 4:26325299-26325321 ATGTAGAAGCTGGATAAAGGTGG - Intronic
971736887 4:30465128-30465150 ATGAAGAAGGAGGAAAAAGTTGG + Intergenic
971738935 4:30495977-30495999 GTGAAGAAGGAGGATAAACAGGG - Intergenic
971894032 4:32566775-32566797 ATGTTGAAGGAAAATGATGATGG + Intergenic
971923627 4:32976951-32976973 ATGTTGAAGGAGGCTGAAAGAGG - Intergenic
972162988 4:36247630-36247652 AAGTAGAAGGAGGAAAAGGAGGG - Intergenic
972313039 4:37899178-37899200 AGGTAGTAATAGGATGAAGAAGG + Intronic
972452454 4:39216003-39216025 CTGTTGAAGGAGTATGAAAATGG + Exonic
973124345 4:46565697-46565719 CTGTTGAAGGAGGATGGAGGGGG + Intergenic
974686984 4:65243108-65243130 GAGGAGAAGGAGGAAGAAGAAGG + Intergenic
975043827 4:69777538-69777560 ATGGAGAAAGAGGAAGACGATGG + Intronic
975051172 4:69866796-69866818 ATGTAGAAAGCTGATGAAGCTGG + Intergenic
975209867 4:71688006-71688028 ATGAATATGGAGGGTGAAGAAGG - Intergenic
975316481 4:72959030-72959052 ATGGAGAAGGTGGATCTAGAGGG - Intergenic
975329571 4:73099089-73099111 CTGGAGAAGGAGGAAGAGGAGGG + Intronic
975495415 4:75030890-75030912 ATGTAAGAGGAGGAGGAGGAGGG + Intronic
975712940 4:77178660-77178682 CTGTGGAAGGAGAAGGAAGAGGG + Intronic
976359496 4:84160945-84160967 AAGAAGAAGGAAGATGAGGAAGG - Intergenic
977277084 4:94991164-94991186 CAGTAGAAGGAGAATGAAAAAGG - Intronic
977572324 4:98641681-98641703 ATGTTGAATTAGGATGAAGTCGG - Intronic
978128982 4:105170942-105170964 GTGTAGAAGGAGGAGGAAGTTGG - Intronic
978235815 4:106458543-106458565 AGGAAGAAGAAGGAGGAAGAAGG + Intergenic
978264747 4:106810305-106810327 AAGAAGGAGGAGGAGGAAGAAGG - Intergenic
978264777 4:106810417-106810439 AGGAAGAAGAAGGAAGAAGAAGG - Intergenic
978792334 4:112675814-112675836 CTGTAAAAGAAGGATGCAGATGG - Intergenic
979025707 4:115571853-115571875 ATGGAGAAGAAGGATGTACATGG + Intergenic
979048927 4:115904848-115904870 ATGTTGAAGGAGAATGAAGAGGG + Intergenic
979129963 4:117031335-117031357 ATGAGGAAAGAGGATGAACAAGG - Intergenic
979369603 4:119868448-119868470 AGGTAGAAGGAACATGAAGAAGG + Intergenic
979654729 4:123179207-123179229 ATCTAGAAGGAGGAGTAGGATGG + Intronic
980190694 4:129520552-129520574 AAGAAGAAGAAGGAGGAAGAGGG + Intergenic
980742568 4:136972046-136972068 AAGAAGAAGGATGAAGAAGAAGG + Intergenic
980742570 4:136972059-136972081 AAGAAGAAGGAGGAAGAAGAAGG + Intergenic
980771997 4:137385853-137385875 ATGTAGAAGGATGATATATATGG + Intergenic
980910789 4:138992510-138992532 AGGGAGGAGGAGGAGGAAGAAGG + Intergenic
981025053 4:140069476-140069498 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
981025068 4:140069537-140069559 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
981041637 4:140228244-140228266 ATGAAGAAGGAGGAGGAGGAGGG - Intergenic
981065606 4:140481435-140481457 ATGTAGAAGTAGGATTGACAGGG - Intronic
981084319 4:140667408-140667430 TTGAACAAGGAGGATGAAAATGG + Intronic
981666603 4:147234174-147234196 GAGAAGAAGGAGGAAGAAGAAGG + Intergenic
981743675 4:148030781-148030803 AGGTAGAATGAGCATGCAGAGGG - Intronic
981797528 4:148613945-148613967 ATCTAGAAGCTGGATGAATATGG + Intergenic
982035975 4:151346037-151346059 ATATAGAGTGAAGATGAAGAAGG - Intergenic
982216620 4:153088001-153088023 ATGTAGAAGCAGCACCAAGAGGG + Intergenic
982226244 4:153170127-153170149 AAGGAGAAGGAGGAGGAAGAGGG + Intronic
982259333 4:153480759-153480781 ATATAGAAGGAAGTTGAACATGG + Intronic
982686548 4:158497162-158497184 ATGTCGGAGGAGGCAGAAGATGG + Intronic
983845064 4:172507485-172507507 ATGTAGGAGGAGGAACCAGAAGG - Intronic
984937914 4:184905543-184905565 ATGTGGAATAAGGATGAGGATGG - Intergenic
985031392 4:185794260-185794282 ATGGAGAAGGAGGAGGAGGGAGG + Intronic
985168343 4:187121810-187121832 AAGTAGAAGGAGGAAGAGGAGGG + Intergenic
1202769830 4_GL000008v2_random:193762-193784 CTGTAGAAGAAGGAAGAACAGGG - Intergenic
986102296 5:4625100-4625122 ATGGAGATGGATGATGATGATGG + Intergenic
986391053 5:7288684-7288706 AAGAAGAAGAAGGAAGAAGAAGG - Intergenic
986414192 5:7511794-7511816 GTGTAGAGGGAGTATGAACATGG + Intronic
986431440 5:7685040-7685062 TTGTGGGAGGAGGATGAAGAAGG - Intronic
986522320 5:8633015-8633037 TTGGAGGAGGAGGATGAAGGGGG + Intergenic
987032852 5:13991503-13991525 AAGGAGAAGGAGGAAGAGGAGGG + Intergenic
987675350 5:21066177-21066199 TTGTAAAAGCAGGAGGAAGAGGG - Intergenic
987736283 5:21847587-21847609 ATGCAGAAGAAGGAAGCAGAAGG - Intronic
987985795 5:25144179-25144201 AAGGAGGAGGAGGAGGAAGAGGG + Intergenic
988632071 5:32942294-32942316 AAGAAGAAGGAGGAGGACGAGGG + Intergenic
988688381 5:33547966-33547988 CAGGGGAAGGAGGATGAAGAGGG + Intronic
989193739 5:38695674-38695696 ATGGGGAAAGAGGAGGAAGAAGG - Intergenic
990123430 5:52484364-52484386 AAGAAGAAGGAGAATGAGGAGGG + Intergenic
990550741 5:56875623-56875645 GTGGAAAAGGAGGATGAGGAAGG - Intronic
991191496 5:63879399-63879421 CTGAAGAAGGATGATGAATAAGG + Intergenic
991230512 5:64328018-64328040 TTCCAGAAGGAGGAGGAAGAGGG + Intronic
991269883 5:64767542-64767564 CTGTAGAAGGAGGTTCAAAAAGG + Intronic
991502608 5:67292004-67292026 ATGTAGAATGGGCATTAAGATGG - Intergenic
992078456 5:73213242-73213264 AAGAAGAAGAAGGAAGAAGAAGG + Intergenic
992090684 5:73313135-73313157 AAGAAGAAGGAGGAGGAAGAAGG - Intergenic
992142102 5:73808830-73808852 GAGAAGAAGGAGGAAGAAGAAGG - Intronic
993252715 5:85549591-85549613 ATGAAGAGTGAGGACGAAGAAGG + Intergenic
993407929 5:87535315-87535337 ATGAAGAAGGAGGAGTAAGTAGG - Intergenic
993934976 5:93988038-93988060 ATGTAAGGGGAGGATGAAGGAGG - Intronic
994045460 5:95304415-95304437 GTGTAGAAGGAAAATGAAAAAGG + Intergenic
994825392 5:104707621-104707643 AAGAAGAAGGAGGAGGAGGAAGG + Intergenic
994927210 5:106132249-106132271 AAGAACAAGGAAGATGAAGAAGG + Intergenic
995143272 5:108758018-108758040 ATTTTGAAAGAGGATGAAGATGG + Intronic
995638597 5:114225350-114225372 ATATAGAAGAAGCATCAAGAAGG + Intergenic
995995991 5:118300044-118300066 AGAAAGAAGGAGGAGGAAGAAGG + Intergenic
996303329 5:122015950-122015972 GTATATAAGGAGGATGAAGGGGG - Intronic
996606568 5:125329977-125329999 AAGAAGAAGAAGGAAGAAGAAGG + Intergenic
997262307 5:132474612-132474634 ATGAAGAAGGAGGAGGCAGAAGG - Intronic
997345479 5:133188420-133188442 ATGCAGAAGGGGGATGCAGTGGG - Intergenic
997506534 5:134421993-134422015 AAGGAGAAGGAGGAAGAGGAAGG - Intergenic
997506554 5:134422113-134422135 TCTTAGAAGGAGGAAGAAGAGGG - Intergenic
998410464 5:141906702-141906724 AGAAAGAAGGAGGAAGAAGAAGG + Intergenic
998410465 5:141906712-141906734 AGGAAGAAGAAGGAAGAAGAAGG + Intergenic
999044839 5:148455921-148455943 GAGGAGGAGGAGGATGAAGAGGG + Intronic
999051333 5:148526881-148526903 ATGTAGGGGGAGTATGAAGAGGG + Intronic
999349348 5:150853096-150853118 CTGTAAAAGCAGTATGAAGAGGG - Intronic
999349608 5:150856787-150856809 ATGTATATGGATGAGGAAGAGGG - Intronic
999517200 5:152313490-152313512 AGGAAGAAGGAGGAGGAAAAGGG - Intergenic
999835255 5:155363553-155363575 ATGGGGAAGGAGGAGAAAGATGG - Intergenic
1000072605 5:157754791-157754813 ATGTTGAAAGAGGGTGATGAAGG + Intronic
1000102187 5:158026623-158026645 ATGGAGCAGGAGGGAGAAGAGGG - Intergenic
1000238796 5:159389838-159389860 AACTAGAAGGAGGAGGAATACGG - Intergenic
1000963660 5:167629877-167629899 AAGGAGAAGGAGGAGGAGGAGGG + Intronic
1001132901 5:169079526-169079548 AGGAAGGAGGAGGAGGAAGAAGG + Intronic
1001132904 5:169079539-169079561 AGGAAGAAGGAGGAAGAAGGAGG + Intronic
1001132907 5:169079549-169079571 AGGAAGAAGGAGGAGGAGGAAGG + Intronic
1001737807 5:174021114-174021136 AAGAAGAAGGAGAAGGAAGAAGG + Intergenic
1002067678 5:176660260-176660282 GAGTCGATGGAGGATGAAGATGG - Intergenic
1002108416 5:176891740-176891762 ATGGGGCAGGAGGAGGAAGAAGG - Intronic
1002454955 5:179340662-179340684 CTGTAGAAGGGGGATGATGTCGG + Intronic
1002873973 6:1194310-1194332 ATGTAGAAGAAAGGTGTAGAAGG - Intergenic
1002969125 6:1996093-1996115 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1003099530 6:3166509-3166531 ATGTGAAAGGAGGAGGTAGAAGG - Intergenic
1003285667 6:4731889-4731911 CTGTGGAAGGAGGGGGAAGATGG + Intronic
1003817622 6:9859929-9859951 GAGGAGGAGGAGGATGAAGAAGG + Intronic
1003817626 6:9859942-9859964 ATGAAGAAGGAGGAGGAGAAGGG + Intronic
1004126042 6:12874620-12874642 AGATAGGAGGAGGATGTAGATGG - Intronic
1004266453 6:14152085-14152107 AGGAAGAAGGAAGAGGAAGAAGG - Intergenic
1004460381 6:15829681-15829703 ATGTTGAAGGGGGTTGAGGAAGG + Intergenic
1004569088 6:16827542-16827564 ATTTAGAAGGTAGAGGAAGAGGG + Intergenic
1004919714 6:20365096-20365118 AAGAAGAAGGAGGAGGAAGAAGG - Intergenic
1005002975 6:21261302-21261324 AAGAAGAAGGAGGAGGAGGAAGG + Intergenic
1005588625 6:27301671-27301693 ATGTAGAAGGAGGATAAATCAGG - Intronic
1005651424 6:27888694-27888716 ATGTTGTAGGAGGGTGAAGGAGG + Intergenic
1006469931 6:34223059-34223081 TTGAAGAAGCAGGATGATGATGG + Intergenic
1007041055 6:38722810-38722832 ATGGAGAAGGATGCTGAAGATGG + Exonic
1007714514 6:43848026-43848048 ATGAAGAAGGAGGAGGAAGGTGG + Intergenic
1008042466 6:46816563-46816585 GAGGAGAAGGAGGAAGAAGAAGG + Intronic
1009567311 6:65325218-65325240 AAGGATGAGGAGGATGAAGAAGG - Intronic
1010451800 6:76012437-76012459 GTGAAGCAGGAGGCTGAAGATGG - Intronic
1010787051 6:80015915-80015937 ATTTAGGAGGAGGATCAAGGAGG - Intronic
1011146407 6:84222445-84222467 ATGTAGAATGAGATTGAAAAAGG - Intronic
1011484746 6:87829964-87829986 AAGGAGAAGGAGGAAGAAGGAGG - Intergenic
1011484783 6:87830104-87830126 AAGGAGGAGGAGGAGGAAGAAGG - Intergenic
1011742617 6:90377649-90377671 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1011989327 6:93493392-93493414 ATGGAGAAGGAGGATACACATGG - Intergenic
1012165669 6:95948056-95948078 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1012180768 6:96149979-96150001 ATGGAGAAGGGGGGTAAAGAGGG - Intronic
1012696646 6:102392117-102392139 ATGTTTAATGAGAATGAAGAAGG - Intergenic
1012981969 6:105840660-105840682 CTGTAGAAGGAGGGAGATGAGGG - Intergenic
1013175859 6:107675827-107675849 ATGTAGGAGGTGTATGAAGACGG + Intergenic
1013841400 6:114399117-114399139 AGGGAGAAGAAGGAGGAAGAAGG - Intergenic
1014207567 6:118672782-118672804 AAGAAGAAGGAGGAGGAAGGAGG + Intronic
1014244741 6:119055859-119055881 TTGTAGGAGGAGGAAGAAGAGGG - Intronic
1014510982 6:122322006-122322028 AAGTAGGAGTAGGAGGAAGAAGG + Intergenic
1014829696 6:126088272-126088294 ATATACAGGGATGATGAAGACGG - Intergenic
1014869973 6:126581949-126581971 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1015261370 6:131241280-131241302 ATGGAGAAGGAGAAGGAGGAGGG + Intronic
1016328533 6:142930690-142930712 ATATAGATGGAGGCTGAACAAGG - Intronic
1016735398 6:147473065-147473087 ATGTTTAAGGAGGCTAAAGATGG + Intergenic
1016794723 6:148105753-148105775 ATGGAGGAGAAGGAGGAAGATGG + Intergenic
1016904310 6:149133753-149133775 ATGGAGGATGAGGATGAGGATGG - Intergenic
1017035368 6:150262422-150262444 ATGAAGAAGGAGGGTGGGGAAGG - Intergenic
1017190829 6:151650980-151651002 AGGTTGGAGGAGGAAGAAGAAGG - Intergenic
1018038085 6:159898684-159898706 AGGATGAAGGAGGAGGAAGAGGG - Intergenic
1018153207 6:160960058-160960080 ATTTAGAATGAGGAAGAAGAAGG + Intergenic
1018719677 6:166563225-166563247 CTGGAGAAGGAAGATGGAGAAGG + Intronic
1018729634 6:166638973-166638995 ATGAAGAGGGAGGAAGAAGAGGG + Intronic
1018945398 6:168344394-168344416 TTGGAGACGGAGGAAGAAGATGG - Intergenic
1019006007 6:168796592-168796614 ATGAAGCTGGAGGATGAAGGTGG + Intergenic
1019327636 7:446116-446138 ATGGAGAGGGAGGAAGAAGAGGG + Intergenic
1019484076 7:1280485-1280507 AGGAGGAAGGAGGAAGAAGAAGG + Intergenic
1019484083 7:1280519-1280541 AGGAGGAAGGAGGAAGAAGAAGG + Intergenic
1019522735 7:1468021-1468043 ATGGGGAAGGAGGATGGGGAGGG - Intergenic
1019869267 7:3743702-3743724 ATGTCGGAGGAGGAGGAAGAGGG + Intronic
1020538544 7:9431159-9431181 TTGAAGAAGGATGATGATGAAGG - Intergenic
1021301639 7:18980745-18980767 AAGAAGAAGGAAGAAGAAGAAGG - Intronic
1021364052 7:19753964-19753986 ATGCACAAGGAAGGTGAAGAGGG - Intronic
1021622461 7:22562254-22562276 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
1021886929 7:25148338-25148360 CTGAAGCAGGAGGATGCAGAAGG + Intronic
1022063592 7:26826659-26826681 ATATAGAAGGAGAAAGAAGACGG - Intronic
1022470179 7:30677159-30677181 ATGGAGTCGGGGGATGAAGAAGG + Intronic
1022471784 7:30686059-30686081 ATGAAGCAGGAGGGTGAGGATGG - Intronic
1022770834 7:33471172-33471194 AAGTAAAAGGAGGATGAAACAGG - Intronic
1022771693 7:33480327-33480349 ATACAGAAGAAGGATAAAGAGGG + Intronic
1022921424 7:35019480-35019502 AAGAAGTAGGAGGAAGAAGAAGG + Intronic
1023006730 7:35878272-35878294 AAGGAGAAGGAGGATGAGAATGG + Intronic
1023047089 7:36219590-36219612 AAGAAGAAGGAGGAAGAGGAAGG + Intronic
1023047096 7:36219639-36219661 AAGAAGAAGGAGGAAGAGGAAGG + Intronic
1023097155 7:36672976-36672998 AAGCAGAAGAAGGATGAACACGG + Intronic
1023214496 7:37847531-37847553 AAGAAGAAGGAGAAAGAAGAAGG + Intronic
1023281539 7:38575772-38575794 AAGTGGAAGGAGCATCAAGACGG - Intronic
1023300010 7:38759946-38759968 AAGTGGAAGGAGGACCAAGATGG - Intronic
1024067431 7:45752368-45752390 AAGGAGAAGGAGGATGAGAATGG - Intergenic
1024846259 7:53646192-53646214 AAGAAGAAGGAGGAGGAGGAAGG - Intergenic
1025057869 7:55779679-55779701 AAGAAGGAGGAGGAAGAAGAAGG - Intergenic
1025887753 7:65614429-65614451 AAGAAGGAGGAGGAGGAAGAAGG - Intergenic
1025887791 7:65614601-65614623 AGGAAGAAGGAGGAAGAGGAAGG - Intergenic
1026191896 7:68136464-68136486 AAGAAGGAGGAGGAAGAAGATGG + Intergenic
1026245417 7:68615282-68615304 GAGAAGAAGGAGGAGGAAGAGGG + Intergenic
1026529522 7:71185046-71185068 AAGCAGAAGGAGGAGGAGGAGGG - Intronic
1026620239 7:71943866-71943888 ATGTATAGGCAGGATGAAAATGG + Intronic
1026679851 7:72457602-72457624 TGGGAGAAGGAGGAGGAAGAGGG - Intergenic
1026684923 7:72501457-72501479 AAGGAGGAGGAGGAGGAAGAAGG + Intergenic
1026849707 7:73717200-73717222 AGGGAGGAGGAGGAGGAAGAGGG + Intronic
1026905077 7:74058172-74058194 AAGCAGGAGGAGGAGGAAGAGGG - Intronic
1026917452 7:74129504-74129526 AGGAAGAAGGAGGAGGAGGAGGG + Intergenic
1027489252 7:78802216-78802238 ATGAAGAAGGACTATGAAAAAGG - Intronic
1027773488 7:82435700-82435722 ATGTAGAAGATGGATTAAGGCGG - Intronic
1027893539 7:84009799-84009821 AAGTAGAAGGGGAAGGAAGAAGG + Intronic
1027942450 7:84701553-84701575 ATGTAGACCAAGGAAGAAGACGG + Intergenic
1027957600 7:84900971-84900993 ATGTGGAAGGAGGGGAAAGAGGG + Intergenic
1028164755 7:87525700-87525722 AAGGAAAAGGAGGAAGAAGAGGG + Intronic
1028246828 7:88489565-88489587 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1028686478 7:93594709-93594731 ATGCAGAACGTGGATGAGGAGGG + Intronic
1028921374 7:96314101-96314123 AAGGAGAAGGAGGAGGAAGAAGG + Intronic
1029371409 7:100153373-100153395 ATGCAGACGGAGGAGGGAGAGGG - Intronic
1029423678 7:100484153-100484175 ATGGAGAAGGGGGATGAAGCAGG + Intronic
1029435391 7:100561441-100561463 ATGTAAAAGGAGGGTCCAGATGG - Intronic
1029886461 7:103877810-103877832 AAGAAGAAGGAGGAGGAGGAAGG - Intronic
1030015282 7:105213204-105213226 ATAGAGCAGGTGGATGAAGAAGG + Intronic
1030247246 7:107396568-107396590 AGGTAGAATGAAGATGAACATGG + Intronic
1031165927 7:118226636-118226658 ATGGAGGAGGAGGAAGAAGAGGG + Intronic
1031790686 7:126099344-126099366 AAGTAGAAGAAGAATTAAGAAGG - Intergenic
1031832587 7:126645845-126645867 ATTTAGTAGGAGGTAGAAGAGGG - Intronic
1031863845 7:127015094-127015116 AAGGAGAAGGAGAAGGAAGAAGG + Intronic
1031863849 7:127015122-127015144 AAGGAGAAGGAGAAGGAAGAAGG + Intronic
1031943596 7:127815493-127815515 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
1032039568 7:128548103-128548125 ATGTACCAGGAGGCTGAAGTGGG - Intergenic
1032466797 7:132151257-132151279 AAGGAGGAGGAGGAAGAAGAAGG + Intronic
1032466805 7:132151292-132151314 AAGAAGAAGGAGGAGGAAGAAGG + Intronic
1032473074 7:132192394-132192416 AGGAAGAAGGAGGAGGAGGAAGG + Intronic
1032523110 7:132561274-132561296 AAGGAGGAGGAGGAGGAAGAGGG - Intronic
1032668545 7:134062830-134062852 ATGCAGCAGGAAGATGAAGGTGG - Intronic
1032830311 7:135618149-135618171 AGGTACAAGGAGAAAGAAGATGG + Intronic
1032986176 7:137339827-137339849 ATGTAAAAGCAGGAAGAAAAGGG + Intronic
1033000824 7:137502516-137502538 ATGGAGGAGGAGGAAGAACAAGG + Intronic
1033156924 7:138965070-138965092 CTGCTGAAGGAGGCTGAAGAGGG - Intronic
1033277543 7:139984043-139984065 GTGATGAAGTAGGATGAAGATGG + Intronic
1033445837 7:141421203-141421225 ATTTAGAAGCATGATGGAGAAGG - Intronic
1033787776 7:144754646-144754668 CTGTAGAATGAGGATGATAATGG + Intronic
1033832593 7:145271494-145271516 AAGGAGGAGGAGGAGGAAGAAGG + Intergenic
1033832617 7:145271659-145271681 AAGGAGGAGGAGGAAGAAGAAGG + Intergenic
1034554878 7:151844030-151844052 ATGTAGAAGGAGGTAGAAGGAGG + Intronic
1034554879 7:151844040-151844062 AGGTAGAAGGAGGAGATAGAAGG + Intronic
1034945486 7:155259156-155259178 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1035060539 7:156066256-156066278 ACGTGGAATGAGGATGAGGATGG - Intergenic
1035761785 8:2073825-2073847 ACGTAGCCCGAGGATGAAGAGGG + Intronic
1036280664 8:7397818-7397840 GGGTTGTAGGAGGATGAAGAGGG - Intergenic
1036283710 8:7424284-7424306 GGGTTGTAGGAGGATGAAGAGGG - Intergenic
1036337761 8:7887245-7887267 GGGTTGTAGGAGGATGAAGAGGG + Intergenic
1036340802 8:7913755-7913777 GGGTTGTAGGAGGATGAAGAGGG + Intergenic
1036938617 8:13030235-13030257 ATAGAAAAGGAGCATGAAGATGG - Intronic
1037300254 8:17444021-17444043 GAGGAGAAGGAGGAGGAAGAAGG - Intergenic
1037670241 8:21009225-21009247 GATTAGAAGGAGGATGAAGTTGG - Intergenic
1037683694 8:21119621-21119643 CTGTGGAAGGAGGATGAAGTTGG + Intergenic
1037717847 8:21414830-21414852 ATGTAAAAGCAGCATCAAGAAGG - Intergenic
1038080838 8:24134310-24134332 ATTTAGAGGGACGATGAAAATGG + Intergenic
1038304924 8:26391323-26391345 TTGTGGATGGAGGATGAGGATGG - Exonic
1038483763 8:27919277-27919299 GTGAAGGAGGAGGATGAGGAGGG + Intronic
1039317344 8:36387998-36388020 AAGGAGAAGGAGGAAGAAGAAGG - Intergenic
1039674505 8:39646885-39646907 AAGTAGAAGGAGAATGAAGAGGG + Intronic
1039827273 8:41185192-41185214 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1040869696 8:52087971-52087993 ATGTAGACAGAGGATGAAGATGG - Intergenic
1041326050 8:56665811-56665833 GTGTAGATGAATGATGAAGAGGG + Intergenic
1041831537 8:62160691-62160713 AAGTAGGAGGAGGAGGAAGGAGG + Intergenic
1041880302 8:62741963-62741985 TTGTAGAATAAGGAAGAAGAGGG - Intronic
1042155123 8:65836900-65836922 ATGTAGGGGGAGGAGGAAGGAGG - Intronic
1042256161 8:66806015-66806037 ATGTAGAAGAAATATGAAAAAGG - Intronic
1042833155 8:73053434-73053456 ATGGGGAAGGAGGAGGAGGAGGG - Intergenic
1042852747 8:73233101-73233123 AAGAAGAAGGAGGAAGGAGAAGG - Intergenic
1043024670 8:75050860-75050882 ATGTAGGACGAGATTGAAGAGGG - Intergenic
1043192972 8:77250235-77250257 AGGTAGAGGAAGGATGAAGTTGG + Intergenic
1043256297 8:78141913-78141935 AAGGAGAAAGAGGAAGAAGATGG - Intergenic
1044831147 8:96250675-96250697 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
1045074088 8:98543229-98543251 AGCTGGAAGAAGGATGAAGAGGG + Intronic
1046015602 8:108601132-108601154 AAGGAGAAGGAGGAGGGAGAGGG + Intergenic
1046186616 8:110729759-110729781 AGGTAGAAGGAGGAGAAGGAGGG + Intergenic
1046574889 8:116015309-116015331 GAGCAGAAGGAGGAAGAAGAGGG - Intergenic
1046760716 8:118017217-118017239 ATGTATAAGGAGAATGAGGTAGG - Intronic
1047588838 8:126304319-126304341 ATAAAGCAGGAGGGTGAAGAAGG + Intergenic
1047791123 8:128205010-128205032 ATGAAGAAAGAGGAAGTAGAAGG + Intergenic
1047971307 8:130087024-130087046 AGGTAGAAGGTGGTTTAAGAAGG - Intronic
1048147303 8:131857978-131858000 ATGGAGAAGGAGAAGAAAGAAGG - Intergenic
1048268480 8:133008889-133008911 AGGCAGAAGGATGATGAAGCAGG - Intronic
1048290488 8:133177697-133177719 GAGGAGAGGGAGGATGAAGAAGG - Intergenic
1049261328 8:141640748-141640770 AAGGAGGAGGAGGAAGAAGAAGG - Intergenic
1049733292 8:144190144-144190166 ATGCAGAGGCAGGAGGAAGATGG - Intronic
1050475935 9:6041080-6041102 GAGAAGAAGGAGGATGAGGAAGG - Intergenic
1050584556 9:7097070-7097092 ATGTGGGAGTGGGATGAAGAAGG - Intergenic
1050623461 9:7478562-7478584 ATGTTCAAGGAGGAAGAACACGG - Intergenic
1051208856 9:14720145-14720167 GTGAAGACGGAGCATGAAGATGG - Exonic
1052406837 9:28072033-28072055 ATGTAGAAGGAGGATGAAGATGG - Intronic
1052973573 9:34396384-34396406 ATGAGGAAGGAGGATGTAGGTGG - Intronic
1053149803 9:35736240-35736262 AGGTACAAGGAGGAGGCAGAAGG - Exonic
1053542039 9:38983589-38983611 ATATAGAGAGACGATGAAGAGGG + Intergenic
1053658852 9:40249227-40249249 CTGTAGAAGAAGGAAGAACATGG + Intronic
1053806380 9:41806218-41806240 ATATAGAGAGACGATGAAGAGGG + Intergenic
1053909221 9:42878499-42878521 CTGTAGAAGAAGGAAGAACATGG + Intergenic
1054359515 9:64100194-64100216 CTGTAGAAGAAGGAAGAACAGGG + Intergenic
1054370972 9:64395517-64395539 CTGTAGAAGAAGGAAGAACATGG + Intronic
1054408031 9:64778908-64778930 AAGTAGGAGGAGGAGGAAGAGGG + Intergenic
1054525746 9:66126995-66127017 CTGTAGAAGAAGGAAGAACATGG - Intronic
1054624101 9:67380321-67380343 ATATAGAGAGACGATGAAGAGGG - Intergenic
1054678603 9:67885246-67885268 CTGTAGAAGAAGGAAGAACATGG + Intronic
1054991453 9:71331869-71331891 AGGAAGAAAGAGGAGGAAGAAGG + Intronic
1055660105 9:78494735-78494757 AGCTAGAAGAAGGAGGAAGAAGG + Intergenic
1056513353 9:87327100-87327122 AGGAAGAAGAAGGATGAGGAGGG + Intergenic
1056608017 9:88103364-88103386 ATGAGGAAAGAGGAGGAAGATGG - Intergenic
1056697627 9:88873345-88873367 AAGAAGAAGAAGGAAGAAGAAGG + Intergenic
1057185543 9:93055642-93055664 ATGGAGAAGGAGGGTGAGGAAGG + Intergenic
1057226652 9:93296425-93296447 ATGGAGAAGGAGGAAGGTGAGGG - Intronic
1057532996 9:95870906-95870928 GAAAAGAAGGAGGATGAAGAGGG - Intergenic
1058135753 9:101305960-101305982 ATAAAGAAAGAGGATGATGAAGG - Intronic
1058561449 9:106233207-106233229 AGGAAGAAAGAGGAGGAAGAAGG - Intergenic
1058561453 9:106233233-106233255 AGGAAAAAGGAGGAGGAAGAAGG - Intergenic
1058561459 9:106233259-106233281 AGGAAGAAGGAGGAGGAAAAAGG - Intergenic
1058561462 9:106233272-106233294 AGGAAGAAAGAGGAGGAAGAAGG - Intergenic
1058561469 9:106233307-106233329 AAGAAAAAGGAGGAGGAAGAAGG - Intergenic
1058561472 9:106233320-106233342 AAGAAGAAGGAGGAAGAAAAAGG - Intergenic
1058561475 9:106233343-106233365 AAGAAGGAGGAGGAGGAAGAGGG - Intergenic
1058561481 9:106233369-106233391 AAGGAGGAGGAGGAGGAAGAGGG - Intergenic
1058563027 9:106249883-106249905 AGGAAGAAGAAGGAAGAAGAAGG - Intergenic
1058719085 9:107747341-107747363 ATGAGAAAGGAGGATGAGGAGGG + Intergenic
1058767123 9:108192424-108192446 ATGTAAGAGGCGGATGAAGAAGG - Intergenic
1058951617 9:109909249-109909271 CTGAAGCAGGAGGATGCAGAAGG - Intronic
1059072479 9:111153014-111153036 AGGAGGAAGGAGGAGGAAGAAGG + Intergenic
1059160674 9:112032099-112032121 AAGGAGAAGGAGGAGGAAGAAGG + Intergenic
1059287339 9:113186177-113186199 ATGAAGGAGGAGCAAGAAGAGGG + Intronic
1059714170 9:116898108-116898130 ATGTGGAAGGAGTTTGAAGCTGG + Intronic
1059756425 9:117297837-117297859 GGGTAGAAGGAGGATGAGGTTGG - Intronic
1060287137 9:122263980-122264002 ATTTAGTAGGAGGAAAAAGATGG - Intronic
1060579494 9:124731622-124731644 ATGCTGAAGGAGGAGAAAGAGGG - Intronic
1060623593 9:125090459-125090481 AGGAAGGAGGATGATGAAGAAGG + Intronic
1060709678 9:125846641-125846663 ATGTAGAAGGAGAAAGCTGATGG - Intronic
1060826957 9:126693141-126693163 GTGAAGAGCGAGGATGAAGATGG + Exonic
1061046967 9:128170755-128170777 AGGTAGAAGGTGGAAGCAGAAGG - Intronic
1061237522 9:129351460-129351482 ATGAATTAGGAGGATGGAGAAGG + Intergenic
1061613627 9:131764748-131764770 GTGGAGAAGGAGGAAGAGGAGGG - Intergenic
1061726511 9:132584854-132584876 ATGGAGAAGGGGGAGGAGGAAGG + Intronic
1062017664 9:134299307-134299329 ATGTAGAAAGAGGTTTATGATGG - Intergenic
1062451926 9:136619375-136619397 CTGAAGGAGGAGGAGGAAGAGGG + Intergenic
1062638386 9:137503502-137503524 AAGGAGAAGGAGGAGGAGGAAGG + Intronic
1062638398 9:137503540-137503562 AAGGAGAAGGAGGAGGGAGAAGG + Intronic
1062638407 9:137503575-137503597 AAGGAGAAGGAGGAGGGAGAAGG + Intronic
1062638411 9:137503594-137503616 AAGGAGAAGGAGGAAGAAGGAGG + Intronic
1062638414 9:137503604-137503626 AGGAAGAAGGAGGAGGGAGAAGG + Intronic
1062638418 9:137503617-137503639 AGGGAGAAGGAGGAGGGAGAAGG + Intronic
1062638424 9:137503636-137503658 AAGGAGAAGGGGGAGGAAGAAGG + Intronic
1062638454 9:137503840-137503862 AAGAAGAAGGAAGAAGAAGAAGG + Intronic
1062638459 9:137503880-137503902 AAGAAGAAGGAAGAAGAAGAAGG + Intronic
1062638462 9:137503920-137503942 AAGAAGAAGGAAGAAGAAGAAGG + Intronic
1062638465 9:137503957-137503979 AGGAAGAAGGAAGAAGAAGAAGG + Intronic
1062638467 9:137504004-137504026 AAGAAGAAGGAAGAAGAAGAAGG + Intronic
1062638473 9:137504064-137504086 AAGAAGAAGGAAGAAGAAGAAGG + Intronic
1062638474 9:137504074-137504096 AAGAAGAAGAAGGAAGAAGAAGG + Intronic
1203694730 Un_GL000214v1:87440-87462 CTGTAGAAGAAGGAAGAACAGGG - Intergenic
1203704821 Un_KI270742v1:29992-30014 CTGTAGAAGAAGGAGGAACAGGG + Intergenic
1203559184 Un_KI270744v1:35819-35841 CTGTAGAAGAAGGAAGAACAGGG - Intergenic
1203641543 Un_KI270751v1:16623-16645 CTGTAGAAGAAGGAAGAACAGGG + Intergenic
1185504972 X:625227-625249 GAGTAGAAGGAGGAGGAGGAGGG - Intronic
1185815174 X:3148334-3148356 TTGGAGAAGAAAGATGAAGAGGG + Intergenic
1185830057 X:3292881-3292903 AGGAAGAAGAAGGAAGAAGAAGG + Intergenic
1186175588 X:6922885-6922907 ATGTAGCTGGAGGATGAAGAGGG - Intergenic
1186299835 X:8188194-8188216 AAGGAGAAGGAGTAGGAAGATGG + Intergenic
1186361441 X:8846105-8846127 AAGGAGAAGGAAGAGGAAGAAGG - Intergenic
1186402601 X:9273619-9273641 AGGAGGAAGGAGGAAGAAGAAGG + Intergenic
1186402607 X:9273647-9273669 AGGAGGAAGGAGGAAGAAGAAGG + Intergenic
1187025747 X:15433932-15433954 AGGAAGAAGGAGGAGGAGGAAGG + Intronic
1187025837 X:15434419-15434441 AGGAAGGAGGAGGAGGAAGAAGG + Intronic
1187920584 X:24197534-24197556 ATGGAGAAGGAGGATAGATATGG + Intronic
1188089190 X:25941301-25941323 ATGCAGAAGGTGGATGGAGAAGG + Intergenic
1188156399 X:26748296-26748318 CTGGAGAAGGAGGAAGAGGAGGG + Intergenic
1188344391 X:29045976-29045998 AAGGAGGAGGAGGAGGAAGAAGG - Intronic
1188402072 X:29757893-29757915 TTATAGACGGAGGAAGAAGAGGG + Intronic
1188471088 X:30540098-30540120 AAGAAGAAGGAAGAAGAAGAAGG + Intergenic
1189289098 X:39872753-39872775 AGGGAGAAGGAGGACAAAGAAGG - Intergenic
1189318207 X:40070572-40070594 TTGTTGAAGTAGGATGAACATGG - Intronic
1189386340 X:40539811-40539833 CTGTAGGAGGAGGAGGAAGTGGG - Intergenic
1189822475 X:44883777-44883799 ATGTAGCAAGAGGAAAAAGAGGG + Intronic
1190123397 X:47682630-47682652 AGGAAGGAGGAGGATGAAGAGGG - Intergenic
1191699307 X:64022354-64022376 CTCTTGCAGGAGGATGAAGATGG - Intergenic
1191821800 X:65318383-65318405 AAGAAGAAGAAGGAAGAAGAAGG - Intergenic
1192068516 X:67912112-67912134 ATATAGAATGTGTATGAAGATGG - Intergenic
1192503002 X:71665503-71665525 GAGGAGGAGGAGGATGAAGAGGG + Intergenic
1192786003 X:74336068-74336090 TGGCAAAAGGAGGATGAAGAAGG + Intergenic
1192947711 X:75983937-75983959 AGGGATAAGGAGGAAGAAGAAGG - Intergenic
1193102974 X:77636788-77636810 AAGAAGAAGGAGAAGGAAGAAGG + Intronic
1193102989 X:77636841-77636863 AGGTGGAAGGAGGAGGAAGGAGG + Intronic
1193103021 X:77637008-77637030 AAGAAGGAGGAGGAAGAAGAAGG + Intronic
1193478949 X:82002965-82002987 AAGTAGTAGGAGGAGAAAGATGG - Intergenic
1194049027 X:89045301-89045323 AAGGAGAAGGAGGAAGAAGAAGG - Intergenic
1194403207 X:93462594-93462616 ATGGAGAAAGAAGGTGAAGAGGG + Intergenic
1194472304 X:94311848-94311870 ATGTCGAAGGACCAAGAAGAAGG - Intergenic
1194823273 X:98531280-98531302 TGGTTGAAGGTGGATGAAGATGG + Intergenic
1194945364 X:100060214-100060236 ATGTAGTATGATGAAGAAGAAGG - Intergenic
1195081374 X:101374640-101374662 AAGTAGAATGAGGAAGAAAATGG + Intronic
1195177830 X:102327838-102327860 ATGTAGAGAGAGGAAGCAGAGGG - Intergenic
1195181034 X:102359255-102359277 ATGTAGAGAGAGGAAGCAGAGGG + Intergenic
1195294591 X:103463498-103463520 AGGAAGAAGGAGGAGGGAGAGGG + Intergenic
1195450626 X:105008264-105008286 ATGCATGAGGATGATGAAGATGG + Intronic
1196046702 X:111263715-111263737 ACGTAGAAGTATGATGAAGGAGG + Intronic
1196477755 X:116108601-116108623 AAGGAGGAGGAGGAAGAAGAAGG - Intergenic
1196988584 X:121302331-121302353 ATATAGAATGAAGATGAACATGG - Intergenic
1197643723 X:128994378-128994400 GTGTGGAAGGGGGATGAGGAGGG + Intergenic
1198041219 X:132854207-132854229 ATGTTGTAGGATCATGAAGATGG - Intronic
1198479792 X:137030929-137030951 GTGGAGAATGAGGATGAAGAGGG - Exonic
1198592008 X:138194042-138194064 ATGCACAAGGAAGATAAAGAGGG + Intergenic
1198820795 X:140646205-140646227 ATGTTGAATGAAGAGGAAGAAGG + Intergenic
1199109926 X:143919733-143919755 AGAGAGAAGGAGGAAGAAGAAGG + Intergenic
1199323154 X:146464588-146464610 CTGTTTAAGGAGGATAAAGATGG + Intergenic
1199751573 X:150824242-150824264 AAGGAGGAGGAGGAGGAAGAAGG + Intronic
1199871038 X:151899267-151899289 ATGTAGCAAGTGGATGAAGCAGG + Intergenic
1200002511 X:153069324-153069346 AAGTAGGAGGAGGAGGAGGAAGG + Intergenic
1200005213 X:153080686-153080708 AAGTAGGAGGAGGAGGAGGAAGG - Intergenic
1200801613 Y:7392399-7392421 AAGGAGAAGGAGGAAGAAAAAGG - Intergenic
1200909003 Y:8514575-8514597 ATGGAGAGGGAGGAGGAAAAGGG - Intergenic
1201422824 Y:13818956-13818978 AGGAGGAAGGAGGAGGAAGAAGG - Intergenic
1201540079 Y:15096555-15096577 ATGGAGAGGGAGGGAGAAGAAGG - Intergenic
1201739754 Y:17311286-17311308 AAGGAGGAGGAGGAAGAAGAAGG - Intergenic
1201761582 Y:17545266-17545288 ATGGAGAATGAGGAGAAAGAAGG + Intergenic
1201839970 Y:18360724-18360746 ATGGAGAATGAGGAGAAAGAAGG - Intergenic