ID: 1052407532

View in Genome Browser
Species Human (GRCh38)
Location 9:28081174-28081196
Sequence AAGGTGCTACTGCATCTAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 1, 2: 0, 3: 24, 4: 91}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052407532_1052407539 28 Left 1052407532 9:28081174-28081196 CCCACTAGATGCAGTAGCACCTT 0: 1
1: 1
2: 0
3: 24
4: 91
Right 1052407539 9:28081225-28081247 AGACATTGCCAAATGTCCCCAGG 0: 152
1: 488
2: 982
3: 1199
4: 1327
1052407532_1052407540 29 Left 1052407532 9:28081174-28081196 CCCACTAGATGCAGTAGCACCTT 0: 1
1: 1
2: 0
3: 24
4: 91
Right 1052407540 9:28081226-28081248 GACATTGCCAAATGTCCCCAGGG No data
1052407532_1052407541 30 Left 1052407532 9:28081174-28081196 CCCACTAGATGCAGTAGCACCTT 0: 1
1: 1
2: 0
3: 24
4: 91
Right 1052407541 9:28081227-28081249 ACATTGCCAAATGTCCCCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052407532 Original CRISPR AAGGTGCTACTGCATCTAGT GGG (reversed) Intronic
900835567 1:5000755-5000777 AAGGTGGTGCTGCCTCTATTTGG + Intergenic
901408720 1:9067745-9067767 AGGGAGCTACTGCGTCTAGAAGG + Intronic
907100314 1:51827083-51827105 AAGGAGCTACTACAGCTAGGAGG + Intronic
909198058 1:72651453-72651475 AAGGTGCAAATGCATGTAGTGGG - Intergenic
909292206 1:73897947-73897969 AAGACACTACTGCATCTAGAAGG + Intergenic
911663175 1:100526087-100526109 AACGGGCTACTGCCTCTGGTGGG + Intergenic
914708053 1:150187688-150187710 GGAGTGCTACTGCATCAAGTGGG - Intergenic
921336545 1:214092771-214092793 TTGGTGGGACTGCATCTAGTTGG - Intergenic
922082279 1:222308769-222308791 AAGGTGCCACTGAATCCACTGGG - Intergenic
922177878 1:223211183-223211205 GAGGTACTATTGCATCTTGTGGG - Intergenic
922331588 1:224581630-224581652 ACAGTGCTATTGCATATAGTTGG + Intronic
1070036438 10:72729832-72729854 GAAGTGCTACTGCACCTAGTGGG - Intronic
1074729861 10:116359553-116359575 AGGGTGCTACTGCATCTAGTGGG - Intronic
1074824441 10:117204424-117204446 AAAGTGCTATTGCATCTGGTGGG - Intronic
1082048575 11:47751470-47751492 GGAGTGCTACTGTATCTAGTGGG - Intronic
1087991551 11:104749610-104749632 ATAATGCTAATGCATCTAGTTGG - Intergenic
1088979903 11:114852880-114852902 AGGATGCTATTGCATCTAGTGGG - Intergenic
1089850131 11:121488443-121488465 AAGGTGCAACTGCATGGAGAAGG - Intronic
1090324918 11:125877095-125877117 AGAGTGCTGCTGCATCTAGTGGG + Intergenic
1091267060 11:134278830-134278852 GAGCTGCTACTGCATGTATTGGG + Intronic
1091701765 12:2668043-2668065 AATATGCTTCTGCATCAAGTTGG - Intronic
1095906382 12:47382478-47382500 AGGATGCTACCCCATCTAGTGGG + Intergenic
1097015281 12:55981709-55981731 ATGGGTCTCCTGCATCTAGTGGG + Intronic
1097207368 12:57334136-57334158 GAGCTGCTACTGCAGCCAGTTGG - Intronic
1099288644 12:80747243-80747265 GAGGTGTTACTGGATCTAGTGGG + Intergenic
1104576537 12:129971862-129971884 GAGGTGCTATGGCACCTAGTGGG - Intergenic
1105254903 13:18737884-18737906 AAGGTGGAACTGCAGCCAGTAGG - Intergenic
1109417302 13:62058667-62058689 AAGGTGCTACTGCATAAAACAGG - Intergenic
1112576510 13:100641225-100641247 ATGGTGCTAATGTTTCTAGTGGG - Intronic
1119428000 14:74548264-74548286 AAGGTGCTACTGGACCTATGAGG + Intronic
1120735772 14:88050591-88050613 AAGGTGATTCTGAATTTAGTAGG + Intergenic
1130890919 15:88133225-88133247 AAGGGGCTGCTGCATCTCGTGGG + Intronic
1131372432 15:91894105-91894127 AATGTGCTACTGCATCTGCCTGG - Intronic
1134145431 16:11757102-11757124 AAGTTGCTCAGGCATCTAGTGGG - Intronic
1140710607 16:77673910-77673932 AAGTTGCTACATTATCTAGTTGG - Intergenic
1145053610 17:19683244-19683266 AAAGTGTTACAGCATCTAGTGGG + Intronic
1148221890 17:45868839-45868861 GAGGTGCTATAGCATCTAGTGGG + Intergenic
1148427031 17:47607712-47607734 AAGGTGCAACTGAAACTATTTGG + Intronic
1149250707 17:54765842-54765864 AAAGTACTACTGCATCTAATGGG + Intergenic
1157882870 18:51338434-51338456 GAGGTGCTACTGGTTCTACTGGG - Intergenic
1158571696 18:58601972-58601994 GGGGTGCTACTGCATCTGGCGGG - Intronic
1159580117 18:70225814-70225836 AAGATGCTACTTCAAGTAGTGGG - Intergenic
1163182029 19:15611131-15611153 AAGGTGAAACTCCAGCTAGTGGG + Intergenic
1163832247 19:19552678-19552700 GAGGTGCTTCCGCATCCAGTGGG - Intergenic
929071463 2:38035757-38035779 AAGATGCTCCTGCATCTTGCTGG - Intronic
930339905 2:50099058-50099080 AAGGAGCTACAGCATCCTGTAGG - Intronic
934489871 2:94755096-94755118 AAGGTGGAACTGCAGCCAGTGGG - Intergenic
935748808 2:106212581-106212603 AAGGGGGTACTGCCTCTGGTAGG - Intergenic
938702377 2:133891083-133891105 ACGATGCTACTACATCTAGTGGG + Intergenic
943016579 2:182517817-182517839 AAGGTGTTTCTGCATTTAGTGGG - Intronic
948858602 2:240742239-240742261 AAGCTGCTTCTGCAGCTGGTGGG - Intronic
1173360261 20:42337887-42337909 AAGGTTCTACTCTATTTAGTAGG - Intronic
1173903880 20:46611680-46611702 AAGCTGCTACTGTCTCTTGTCGG + Intronic
1174699668 20:52595228-52595250 AGGGTGCTACTGGCACTAGTGGG + Intergenic
1174728077 20:52885956-52885978 AGGGTACTACTGCATCAAGTTGG + Intergenic
1174782511 20:53402787-53402809 AAGGTGCTTCTGCCCCAAGTGGG + Intronic
1175898115 20:62348881-62348903 AAGGTGCTCCTGTATCTAATGGG + Intronic
1179628819 21:42664376-42664398 ATGGTGCTGCTGCATTGAGTAGG + Intronic
1185030564 22:48440852-48440874 AGGGGGCTCCCGCATCTAGTGGG - Intergenic
953013933 3:39054372-39054394 GAGATGCTACTACATCTAGTTGG - Intronic
955790735 3:62586382-62586404 AAGCTGATACAGCATCTAGAAGG - Intronic
956118397 3:65941520-65941542 AGAGTGCTACTGCATCTACAGGG - Intronic
956469422 3:69550700-69550722 TAGAGGCTACTGCATCTAGTAGG - Intergenic
958263656 3:91411874-91411896 AAGATGCTACTGTAACTAGTAGG - Intergenic
963536023 3:146529366-146529388 AAGATAATACTGCATCTGGTGGG + Intronic
966197502 3:177327961-177327983 CAGGTGCTACTGGATCTGCTGGG + Intergenic
969592753 4:8131226-8131248 AAGCTGCTGCTGCATGTGGTTGG - Intronic
972587449 4:40450797-40450819 AGGGGGCTTTTGCATCTAGTGGG - Intronic
975566885 4:75766478-75766500 AGAGTGCTACTGCGTCTAGTGGG + Intronic
978770001 4:112445849-112445871 AAGGTCCAACATCATCTAGTGGG + Intergenic
980603796 4:135062378-135062400 AAGGTGCTATTGCATATTCTTGG + Intergenic
982343583 4:154331656-154331678 ATGGTGCTGCTGCCTTTAGTGGG - Exonic
982981500 4:162142027-162142049 AAGGTGCTATTGTATCTAATGGG + Intronic
983238509 4:165206690-165206712 CAGGTGCTACTGCTTCCAGCGGG + Intronic
985698011 5:1352762-1352784 AAGCTGCTATTGCATCTGGAGGG - Intergenic
986343974 5:6817324-6817346 AAGAAGCTACTGCATCCACTGGG - Intergenic
990480623 5:56206845-56206867 AAGGTGCTACTGCCTGAGGTGGG + Intronic
996403325 5:123085825-123085847 TGGGTGCTCCTGCTTCTAGTAGG - Intergenic
1000382607 5:160642532-160642554 GGGGTGCTAATGCATCTTGTGGG + Intronic
1002518945 5:179779776-179779798 AATATGCCACTGCATTTAGTAGG + Intronic
1003617618 6:7669862-7669884 AGTGTGCTACGGCGTCTAGTGGG - Intergenic
1003889226 6:10549099-10549121 AAGGTGCTACTGGCATTAGTGGG + Intronic
1007688079 6:43679220-43679242 GGAGTGCTACTGCATCTAGCAGG + Intronic
1008055178 6:46938543-46938565 AAGATGCTCCTTCATCTGGTGGG - Intronic
1008991775 6:57611098-57611120 AAGATGCTACTGTAACTAGTAGG + Intronic
1009180291 6:60509344-60509366 AAGATGCTACTGTAACTAGTAGG + Intergenic
1010166209 6:72917984-72918006 GGGGTGCTATTGCGTCTAGTGGG - Intronic
1014758936 6:125333747-125333769 AAGGTACTACTGCAACTCATTGG - Intergenic
1016088805 6:139949825-139949847 AAGGTGCTTATGAATCTAGGAGG - Intergenic
1023454184 7:40320745-40320767 CAGGTGATACTGAATATAGTGGG + Intronic
1023767020 7:43521279-43521301 GTGGTGCTACTGTACCTAGTGGG - Intronic
1031572022 7:123370670-123370692 AAGGTGCTATTGAATTTGGTGGG + Intergenic
1031968211 7:128043526-128043548 ATTGTGCCACTGCATCTAGCTGG + Intronic
1032690092 7:134277048-134277070 AAGGAGCTGCTGCATATAGCAGG + Intergenic
1033383618 7:140849172-140849194 AAGGTGTTACAGAATCTAGGTGG - Intronic
1038558442 8:28546275-28546297 AAGGTGGAACTGCATCTTATGGG - Intronic
1041763130 8:61388478-61388500 AATGTGCTACTGCATTTTTTAGG - Intronic
1044276669 8:90308526-90308548 AAGGTGATACTGCATCAGGTGGG - Intergenic
1046603367 8:116343386-116343408 AAGTAGCTACTGCACCTAGAAGG - Intergenic
1046741166 8:117830584-117830606 AAGGTGCTACTGAATCTTAGAGG - Intronic
1052028141 9:23597478-23597500 AAGCTGCTACTGCCACCAGTGGG - Intergenic
1052407532 9:28081174-28081196 AAGGTGCTACTGCATCTAGTGGG - Intronic
1052500932 9:29289182-29289204 AGGGTGCTACTGAAACTACTGGG - Intergenic
1053667919 9:40329429-40329451 AAGGTGGAACTGCAGCCAGTGGG + Intergenic
1053917726 9:42955716-42955738 AAGGTGGAACTGCAGCCAGTGGG + Intergenic
1054379065 9:64469468-64469490 AAGGTGGAACTGCAGCCAGTGGG + Intergenic
1054516692 9:66046854-66046876 AAGGTGGAACTGCAGCCAGTGGG - Intergenic
1055489629 9:76791808-76791830 CAGGTGCTTCTGAATCTAGTCGG - Intronic
1057475097 9:95392922-95392944 AAGGAGCTACTTCATCTTGGTGG + Intergenic
1186523768 X:10228951-10228973 GGGATGCTGCTGCATCTAGTGGG + Intronic
1187042866 X:15615491-15615513 AGAGTACTACTGCATCTAGTTGG + Intergenic
1187646449 X:21352441-21352463 AATGTGCTACTGGATTTGGTTGG - Intergenic
1192967943 X:76199859-76199881 ATGGTGTTTCTGCATCTATTGGG + Intergenic
1193839586 X:86392953-86392975 GTGGTGCTATGGCATCTAGTGGG + Intronic
1194620793 X:96168709-96168731 AAGATTCTACTTCATCTACTTGG + Intergenic
1198153067 X:133930275-133930297 GAGGTACTCCTGCGTCTAGTGGG + Intronic
1198731654 X:139737078-139737100 GAGGTGCTACAAGATCTAGTTGG + Intronic