ID: 1052409101

View in Genome Browser
Species Human (GRCh38)
Location 9:28099843-28099865
Sequence GAGTTGAACAAGAGGACAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 275
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 248}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052409101 Original CRISPR GAGTTGAACAAGAGGACAGG AGG (reversed) Intronic
900653149 1:3741034-3741056 GAAGTGGACAAGAGGACAGTGGG + Intergenic
901803657 1:11724274-11724296 GAGCTGAGCAGGAGGCCAGGTGG + Exonic
902306480 1:15543456-15543478 GAGTGGAAGAAGAGGGCATGGGG + Intronic
902353805 1:15880863-15880885 GACTTCAACAAGAAGAGAGGAGG + Intronic
905447516 1:38036689-38036711 GAGTTAAAGGAGAGGGCAGGGGG + Intergenic
909256885 1:73435859-73435881 GAGTGGAACACGAGGTCAGGAGG + Intergenic
909619729 1:77653960-77653982 GGGTGGATCAAGAGGTCAGGAGG + Intronic
909797535 1:79760769-79760791 GACTTGGTCAAGAGGACAGATGG - Intergenic
910575136 1:88753801-88753823 GTGTTGAACATGAGGCCTGGCGG - Intronic
912030688 1:105239658-105239680 GAGATAAAGAAGAGGACTGGAGG + Intergenic
913428050 1:118756695-118756717 GAGTTGAAAAAGACTATAGGGGG + Intergenic
913452774 1:119003353-119003375 GAGGAGAATAAGAGGAGAGGTGG + Intergenic
915315438 1:155026174-155026196 GAGTTCAACCAGAGGAGAGCGGG + Intronic
916474649 1:165157658-165157680 GTGTTGAATATGAGGAGAGGAGG - Intergenic
918029839 1:180796032-180796054 GAGTGGATCACGAGGTCAGGAGG - Intronic
918956600 1:191216836-191216858 GTGTTGAAGAAGGGGACTGGTGG - Intergenic
919150447 1:193690453-193690475 GAATTGAACAAGAGAACACTTGG - Intergenic
919197516 1:194307322-194307344 GATTTGAACAAGTGGACAGTAGG + Intergenic
922312512 1:224408654-224408676 GAGTTGGACAGGAGGGCAAGAGG + Intronic
922559263 1:226556606-226556628 GAGATGAACTAGAAGCCAGGAGG + Intronic
923954505 1:239000275-239000297 GAGTAGAATTAGAGGGCAGGAGG + Intergenic
923954757 1:239003739-239003761 TTTTTGAACAAGGGGACAGGAGG - Intergenic
924430937 1:243995835-243995857 GAGTTGGAAATGAGAACAGGAGG - Intergenic
1063421332 10:5914976-5914998 GGGTTGAATAAGTGGATAGGTGG + Intronic
1063747969 10:8907753-8907775 GAGTCGAACAGGAGAAAAGGAGG - Intergenic
1064691846 10:17926637-17926659 GAGTTGAACAACAGGGTAGGAGG - Intergenic
1067662011 10:48243315-48243337 GAGTTAACCAAGAGGAAAGTGGG + Intronic
1067689816 10:48494543-48494565 CAGATGAACAAGTGGACAGATGG - Intronic
1071224806 10:83516390-83516412 CAGAGGAACATGAGGACAGGTGG + Intergenic
1071919517 10:90333669-90333691 TAGTTGAAAAAGAAGACAGGTGG + Intergenic
1074253094 10:111773195-111773217 GAGGTGAATAGGAAGACAGGGGG + Intergenic
1076220119 10:128727200-128727222 AGGTGGAACAAGAGGGCAGGAGG - Intergenic
1077316146 11:1920247-1920269 GAGATGAAAACGAGGACAGGAGG + Intronic
1079932854 11:26586726-26586748 AAGTGGATCAAGAGGTCAGGAGG - Intronic
1081941631 11:46947685-46947707 GAGTTACACAATAGGACAGCTGG - Intronic
1084591473 11:70093038-70093060 GAGGTGAATAAGAGGTGAGGAGG - Intronic
1085313810 11:75531421-75531443 GAGGGGAAGAAGAGGACAGAGGG + Intergenic
1085484949 11:76854926-76854948 GAGCTGTAAAAGAGGACAAGAGG + Intergenic
1085961921 11:81470852-81470874 GAGTTGGAGGAGAGGAAAGGGGG + Intergenic
1088371827 11:109098202-109098224 AAGCTGAACAAGAAAACAGGAGG - Intergenic
1089702597 11:120254552-120254574 GAGGTGAAGAAGTGGAAAGGGGG + Intronic
1090559705 11:127918638-127918660 GAGTTGAACAATAGAACACATGG + Intergenic
1091448633 12:559247-559269 GAGATGAGCCAGAGGCCAGGAGG - Intronic
1091618336 12:2066852-2066874 GAGCTGGAAAGGAGGACAGGAGG + Intronic
1092746947 12:11681771-11681793 GAGTTGAACATGAGAACACATGG - Intronic
1095122168 12:38432587-38432609 GAGGTGGACAAGAAGACAGTGGG - Intergenic
1098132687 12:67366936-67366958 CAGCTAAGCAAGAGGACAGGAGG - Intergenic
1098488043 12:71044629-71044651 GAGATGGACATGAGGACTGGGGG - Intergenic
1099623687 12:85037647-85037669 GAAAAGAACAAGAAGACAGGTGG + Intronic
1100734191 12:97508775-97508797 GAGTTTAACAGAAGGACAGGAGG + Intergenic
1101340038 12:103835250-103835272 GACTTCAACAAGAGGAGAGAAGG + Intronic
1106169667 13:27278137-27278159 GAGTTAAAGAAGGGGAAAGGAGG - Intergenic
1107763663 13:43710145-43710167 GAGAGGAAAAAGAGGGCAGGAGG + Intronic
1109175302 13:59147786-59147808 GATTTGAACAAGAGTACACATGG - Intergenic
1110263784 13:73515528-73515550 GAGTTGAACATGAGAACACATGG - Intergenic
1110511013 13:76350336-76350358 GAGTTGAACATGAGAACACATGG - Intergenic
1110898493 13:80788755-80788777 GAGTTGATCAAGAGGCCTGTGGG - Intergenic
1111018736 13:82417566-82417588 GAGTTGATCATGAGGAAAAGAGG - Intergenic
1111248106 13:85568701-85568723 GAGAGGAACAAGAGGATAGGTGG + Intergenic
1112191073 13:97178195-97178217 GATTTGAACAAGAGGCTAGATGG + Intergenic
1113490058 13:110684430-110684452 GGGATGAACCAGAGGACAGGAGG - Intronic
1113490111 13:110684674-110684696 GGGATGAACCAGAGGACAGGAGG + Intronic
1114807060 14:25849794-25849816 GAGTTGTAAAATAGGAAAGGGGG + Intergenic
1115126717 14:30003763-30003785 GAGGTGAAAAATAGGACATGTGG + Intronic
1115389807 14:32842003-32842025 GAGGAGAGGAAGAGGACAGGAGG - Intergenic
1115414841 14:33120183-33120205 GAGTGGATCATGAGGTCAGGAGG - Intronic
1117467854 14:56011796-56011818 GAGTAGAAAAAAAGGACAGCAGG - Intergenic
1118207321 14:63734800-63734822 AAGCTGAAGAAGAGGACAGCAGG + Intergenic
1118799605 14:69177564-69177586 GAGTTAAACTAGAGGAAAGTAGG + Intergenic
1120110802 14:80553292-80553314 GAGTTGAACATGAGAACACATGG - Intronic
1120584530 14:86295422-86295444 AAGCTGAGCAAGAAGACAGGAGG - Intergenic
1121927153 14:97938152-97938174 GACGTGAACAGGGGGACAGGGGG + Intronic
1122621402 14:103059510-103059532 GAGATGAGCAAGGGGAAAGGGGG + Intergenic
1122703915 14:103608341-103608363 GAGTTTAACAATAGGAGAGGTGG + Intronic
1202905947 14_GL000194v1_random:72594-72616 GAGTGGAACTTGAGGCCAGGTGG + Intergenic
1124151472 15:27182612-27182634 GAGTTGAATGAGATGACGGGAGG + Intronic
1125272866 15:37959058-37959080 GAGTTGAACAAGAGAACACATGG + Intronic
1126759685 15:51958130-51958152 GAGTTGCACAAGGGAACAAGAGG - Intronic
1128325904 15:66723981-66724003 GAGTTCACCAAGAGGACAACAGG + Intronic
1128533923 15:68475663-68475685 AAGTTGAAGAAGAGGAGAAGAGG - Intergenic
1128914703 15:71549255-71549277 GAGTGGAACAAAGGGGCAGGAGG - Intronic
1130156517 15:81355114-81355136 GACTTGTACAAAAGGACATGGGG - Intronic
1131802635 15:96087318-96087340 GAGTCTAACAATAGGACAGGGGG - Intergenic
1131967835 15:97864030-97864052 AAATTGAAAAAGAGGAAAGGAGG - Intergenic
1132506900 16:314837-314859 CAGAGGGACAAGAGGACAGGTGG - Intronic
1132928801 16:2447917-2447939 CACTTGACCAAGAGGACAAGAGG - Intronic
1133853269 16:9525970-9525992 GAGCTTAACTAGAGGACGGGTGG + Intergenic
1134037562 16:11042402-11042424 GAGAGGGACAGGAGGACAGGAGG + Intronic
1134269932 16:12724289-12724311 GAATTGAAGCAGAGGACAGAGGG - Intronic
1134562887 16:15226018-15226040 GTGTTGAAAAAGGGGCCAGGTGG - Intergenic
1134923424 16:18137651-18137673 GTGTTGAAAAAGGGGCCAGGTGG - Intergenic
1136875767 16:33854884-33854906 GAGGGGAGAAAGAGGACAGGGGG - Intergenic
1140405552 16:74708628-74708650 GAATTGTCCAATAGGACAGGAGG - Intergenic
1140426847 16:74868279-74868301 GAGTTAAGCAAAAGCACAGGAGG - Intergenic
1141068325 16:80932021-80932043 GAGATGAGCCAGAGGAGAGGAGG + Intergenic
1141496921 16:84416759-84416781 GAGCTGAACACGGGGAGAGGCGG - Intronic
1144321180 17:14121851-14121873 GATTTGAAGATGAGGAGAGGAGG + Intronic
1146512616 17:33463198-33463220 AAGTTGAACAGGAGGACTGAGGG - Intronic
1149250785 17:54766733-54766755 GGGTTGAACAAGAGAACACATGG - Intergenic
1150546366 17:66161623-66161645 GAGTTGAACATGAGAACACATGG + Intronic
1150952435 17:69818737-69818759 GAGATGAAAAAGAGAACAGCAGG + Intergenic
1153729101 18:7989611-7989633 GAAGTCAACAAGGGGACAGGAGG - Intronic
1154296616 18:13156702-13156724 GAGTTGAACAAGAGTAAGGGGGG - Intergenic
1154958232 18:21280962-21280984 GAGTTGGAAAAGAGGTCTGGAGG + Intronic
1155772512 18:29720008-29720030 GAGCTGATCACGAGGTCAGGAGG + Intergenic
1156282689 18:35656601-35656623 TAGGAGAACAAGAGCACAGGAGG + Intronic
1160694692 19:477856-477878 GAGCAGGACGAGAGGACAGGGGG - Intergenic
1163200174 19:15761036-15761058 GAATTGACAAAGAGGGCAGGGGG + Intergenic
1164234978 19:23323889-23323911 GAGTGGAGAAAGAGGAGAGGAGG - Intronic
1164324390 19:24179249-24179271 GAGAAGAACAAGAGGAGAGGAGG + Intergenic
1164785700 19:30928681-30928703 CAGCTGAACAGAAGGACAGGAGG - Intergenic
1164829778 19:31311539-31311561 GAGATGAAGCAGAGGACAGAAGG + Intronic
1167043128 19:47034549-47034571 AATTTGGACAAGAGGACGGGAGG + Intronic
925242060 2:2339962-2339984 GAGTGGAAGATGAGGACAGAGGG - Intergenic
925876358 2:8314352-8314374 TAGTTGAAGAATAAGACAGGAGG + Intergenic
927411542 2:22831713-22831735 GAGTTGAACATGAGAACACATGG + Intergenic
929520817 2:42649073-42649095 GAGTGGTACTAGAGGCCAGGGGG - Intronic
929837468 2:45418711-45418733 GAGTTGTGCAAGAGGAAAGAAGG + Intronic
931177726 2:59870539-59870561 GCCTTGAACACGAGGCCAGGGGG + Intergenic
931467170 2:62500351-62500373 GAGATGAAGAAGAAAACAGGTGG - Exonic
931624809 2:64247723-64247745 GAGTTGAAATAGGGGATAGGGGG - Intergenic
932674597 2:73768206-73768228 GACTTCAACAAGAGGACTAGAGG - Intronic
933784844 2:85830389-85830411 GAGTTTAGCAAGAAGACAGGAGG + Intergenic
936066890 2:109339411-109339433 CAGAAGACCAAGAGGACAGGAGG - Intronic
937266714 2:120620862-120620884 TAGTTGATAAAGAAGACAGGTGG - Intergenic
937499220 2:122460477-122460499 CAGCTGAACAAGAGGTCAGATGG - Intergenic
937562423 2:123242338-123242360 GAGTTGAAAAAGAGAACATATGG + Intergenic
940132665 2:150401235-150401257 GAGGGGACAAAGAGGACAGGAGG + Intergenic
941231373 2:162915923-162915945 GAGTTGGAGGAGAGGAAAGGGGG - Intergenic
943047446 2:182875445-182875467 GAATTGAACAAGAGAACACATGG + Intergenic
944290085 2:197995285-197995307 GAGTGGAAGAAGAGAAAAGGAGG - Intronic
945342171 2:208669222-208669244 GATCTGAAAAAGAGGGCAGGTGG + Intronic
945911787 2:215658185-215658207 GAGTTGAAGAAGCAGACAGTGGG + Intergenic
946354081 2:219173983-219174005 GTGATGAAGAAGAGGACAGATGG + Intronic
948106925 2:235421768-235421790 GAGTGGAGCAAGAGGAATGGTGG + Intergenic
948807851 2:240460660-240460682 GAGTTGAACAGGAAGGCTGGAGG - Intronic
1170163461 20:13339121-13339143 GAGTTGAACACGAGGTCACATGG + Intergenic
1170290966 20:14767841-14767863 GAGTTGAACAATAGAACACATGG - Intronic
1170876819 20:20257672-20257694 TAGTAGTACAAAAGGACAGGTGG + Intronic
1171389035 20:24789499-24789521 GAGCTGAAGCAGAGGGCAGGGGG - Intergenic
1172024095 20:31936161-31936183 GGGTTGAACAAGACAAGAGGTGG + Intronic
1173411609 20:42816144-42816166 GATTGGAACAGTAGGACAGGTGG + Intronic
1173684767 20:44915385-44915407 GAGTTCAACAAGAGGGATGGGGG + Intronic
1174543690 20:51309048-51309070 GAGCTGGACAATAGGACAAGGGG - Intergenic
1174569248 20:51489361-51489383 GAGTTGAACAGGAGGTAAGAAGG + Intronic
1176999932 21:15599661-15599683 GAGGTGATCAAGTGGAAAGGAGG + Intergenic
1177157167 21:17512113-17512135 GAATTGAAGAAGAGGAGCGGTGG - Intergenic
1180664926 22:17503251-17503273 GAACTGAAGAAGAGTACAGGGGG - Intronic
1180888778 22:19269721-19269743 GAGTTGAACAAGTGAACACATGG + Intronic
1182051473 22:27315858-27315880 GAGATGAAGAGGAGGAGAGGAGG - Intergenic
1182192539 22:28477782-28477804 CAGTTGTACGAGAGGGCAGGTGG - Intronic
1183526737 22:38327564-38327586 GAGTGGAGCAGGAGGACAGAGGG - Intronic
1184900769 22:47445189-47445211 CAGGTGAACAGGAGGACAGGAGG - Intergenic
1184900778 22:47445229-47445251 CAGGTGGACAGGAGGACAGGTGG - Intergenic
1184900809 22:47445366-47445388 CAGGTGAACAGGAGGACAGGTGG - Intergenic
1184900840 22:47445531-47445553 CAGGTGGACAGGAGGACAGGTGG - Intergenic
949531154 3:4956803-4956825 CAGTTGAAAAAGAGGATAGTGGG + Intergenic
950541222 3:13614503-13614525 GAGATGGACAAGAGGATGGGAGG - Intronic
951109052 3:18779533-18779555 GAGTAGGAGAAGAGAACAGGAGG - Intergenic
952905989 3:38139324-38139346 AAGTAGAGCAACAGGACAGGTGG + Intronic
953207724 3:40846635-40846657 GACAGGAACAAGAGGACAAGAGG + Intergenic
955775491 3:62428155-62428177 GAGTTTAACAGAAGAACAGGAGG + Intronic
957069914 3:75559532-75559554 GAGTTGAACAAATGTACAGTCGG - Intergenic
957150490 3:76480055-76480077 GAGCTGAAAAAGAGGAAAAGAGG + Intronic
958192208 3:90197461-90197483 GAATTAAAAAACAGGACAGGAGG - Intergenic
958415613 3:93869389-93869411 GAGTTAAAAAACAGGACATGAGG - Intergenic
959368678 3:105495031-105495053 TAGTGCACCAAGAGGACAGGAGG - Intronic
960216220 3:115041239-115041261 TAATTGAAGAAGAGGACAGATGG - Intronic
960535590 3:118811478-118811500 GAGTTTTACAAGACCACAGGGGG - Intergenic
960723255 3:120645253-120645275 GAGGTGAACAGGATGACAGACGG + Intronic
960909718 3:122637212-122637234 GAGAAGGACAAGAGGACAGTGGG - Intronic
960947805 3:122978807-122978829 GGGTAAAACAAGAGGAGAGGAGG + Intronic
962061465 3:131932134-131932156 GGTTTGGACAGGAGGACAGGAGG + Intronic
962873654 3:139519383-139519405 GAGCTGAAGGAGAGGAAAGGAGG + Intronic
963118661 3:141756773-141756795 GAGTTGAACAATAAGACAAATGG - Intergenic
963797644 3:149647189-149647211 GAGGGGGACAAGAGGACTGGAGG + Intronic
964383822 3:156126232-156126254 CAGGAGAACAAGAGGAGAGGAGG + Intronic
965060137 3:163774195-163774217 GAGTTGAACATGAGAACACATGG - Intergenic
967056235 3:185831045-185831067 GATTGGAACAAGAGGATAGATGG + Intergenic
967287236 3:187884412-187884434 GGGTGGATCAAGAGGTCAGGAGG - Intergenic
967823779 3:193862435-193862457 GAGAGGAAGGAGAGGACAGGAGG - Intergenic
970163978 4:13216818-13216840 GAGTTGAAAATGAGAACATGTGG + Intergenic
971800599 4:31285441-31285463 GAGAAGAGCAAGAGCACAGGGGG - Intergenic
972239840 4:37178532-37178554 GAAATGAACAAGAGCACAAGAGG - Intergenic
972686663 4:41359665-41359687 GAGTGGGACAAGAGGAGATGAGG + Intronic
973532734 4:51849579-51849601 GAGGTGACCCAGAGGACTGGAGG + Intronic
974464848 4:62241943-62241965 GAGTTGAACAATAGAACACATGG + Intergenic
974756757 4:66219106-66219128 GAGGTGAACAAGATTACAGAAGG - Intergenic
975296126 4:72736527-72736549 GAATTGAACAAGAGAACACTTGG + Intergenic
975523657 4:75326706-75326728 GAGTTGGACTTGAGTACAGGTGG + Intergenic
977022895 4:91777598-91777620 GAGTTGAAGAAGAGGACGTAGGG + Intergenic
980570054 4:134602891-134602913 CAGTGGAACAAGAGAACAGATGG + Intergenic
981468652 4:145102940-145102962 GGGTTAAATGAGAGGACAGGAGG + Intronic
981890062 4:149725897-149725919 TAGTAGAACAAGAAGATAGGGGG - Intergenic
982120542 4:152138918-152138940 GAGATGAGCAAGAGTTCAGGTGG - Intergenic
982943813 4:161592475-161592497 GAGTTGAACAATAGAACACATGG - Intronic
983792452 4:171813972-171813994 GAGTTGAACTTGAGTTCAGGTGG + Exonic
983930861 4:173451886-173451908 GTGTTGAACAAGAGGTCAGAAGG + Intergenic
984257837 4:177408737-177408759 GAATGCAATAAGAGGACAGGAGG - Intergenic
984760142 4:183356651-183356673 GAGGTGATCAAGAGGAATGGCGG - Intergenic
984851960 4:184162233-184162255 AAGTTGAACAAGAACACTGGAGG - Intronic
984856798 4:184202419-184202441 GAGTGGAACAGGAGGGGAGGAGG + Intronic
986326255 5:6677098-6677120 CAGTTGAACAAGAGGTGGGGTGG + Intergenic
987435556 5:17888935-17888957 GAGTTCAAGAAAAGGACATGGGG + Intergenic
987962390 5:24827077-24827099 GAGTTGAACATGAGAACACATGG - Intergenic
988402628 5:30781320-30781342 GAGTTGAACAAGAGAACACATGG + Intergenic
988480366 5:31625170-31625192 AAATTGAAGAAGAGGACAGAGGG + Intergenic
989802567 5:45562078-45562100 CAGTTGAACAGAAGTACAGGTGG + Intronic
990286852 5:54309485-54309507 GTGTCCAACAAGATGACAGGAGG + Intronic
993017428 5:82550963-82550985 GAGTGGGAGAAGAGGATAGGTGG - Intergenic
994921125 5:106045565-106045587 GAGTTGAACAACAGGTCAGATGG + Intergenic
997240229 5:132301398-132301420 CAGCTGCAGAAGAGGACAGGAGG - Intronic
998179858 5:139929098-139929120 GAGTTGACCAAGAGCTCAGAAGG - Intronic
999364940 5:151016808-151016830 GAGTTCATCAAGAGGAGAGGTGG - Intergenic
1001427406 5:171632351-171632373 GAGGTGAACGAGAGGAGAGTGGG + Intergenic
1001434241 5:171686947-171686969 GACTGGATCAGGAGGACAGGTGG + Intergenic
1004620718 6:17327946-17327968 GAGTGGATCACGAGGTCAGGTGG + Intergenic
1005021323 6:21421915-21421937 GAGTTGAACAATAGAACACATGG - Intergenic
1007662182 6:43493606-43493628 GAGATGCAGAAGAGGAAAGGAGG - Intronic
1008266145 6:49428981-49429003 GAGTTGAACACGTGGACACAGGG + Intergenic
1008474780 6:51924370-51924392 GAGTTGAAAAACAGGACAGAAGG + Intronic
1009275387 6:61672047-61672069 GAATTGAACAAGAGAACACATGG - Intergenic
1011626618 6:89288322-89288344 GAGTGGAAAAGGAGGAAAGGAGG + Intronic
1011718052 6:90127675-90127697 GAGTTAAAAAAGAAGCCAGGTGG + Intronic
1014411824 6:121134190-121134212 GAGTAGAAGAAGAAAACAGGAGG - Intronic
1015385781 6:132621466-132621488 GAGCTTAACAAGAGTACACGTGG - Intronic
1015823116 6:137283655-137283677 GAGATGATCAGGAGGTCAGGAGG + Intergenic
1016154188 6:140783278-140783300 GAGTGTAACAAGAGGGAAGGAGG + Intergenic
1016801216 6:148170918-148170940 GAGTTGAACATGAGAACACATGG - Intergenic
1017123904 6:151048907-151048929 GAATTGAATAAGAGGACACCTGG - Intronic
1020926307 7:14330623-14330645 CTGTTGAACAAGGGGAAAGGTGG + Intronic
1031015044 7:116565205-116565227 GAGTTAAACAAGATGACAAATGG - Intergenic
1032435661 7:131898355-131898377 CAGTTGTACAAGAGGGTAGGCGG + Intergenic
1032488252 7:132304797-132304819 GGGTTGCAGCAGAGGACAGGGGG - Intronic
1032706700 7:134426186-134426208 GGGATGATTAAGAGGACAGGTGG + Intergenic
1033686815 7:143647572-143647594 GAGCTGGACATCAGGACAGGGGG - Intronic
1033688919 7:143719735-143719757 GAGCTGGACATCAGGACAGGGGG + Exonic
1034189104 7:149200138-149200160 GAGATGCAAAACAGGACAGGTGG - Intronic
1034640316 7:152597053-152597075 GAGTTTAGCATGAGGACAGCTGG - Intergenic
1034835795 7:154350776-154350798 CAGCTGAACAAGGAGACAGGAGG + Intronic
1039851736 8:41373225-41373247 GAGCTGAATAACAGTACAGGTGG + Intergenic
1040360532 8:46660023-46660045 GGGTTGATCACGAGGTCAGGAGG - Intergenic
1040698832 8:50036534-50036556 GAGATGAACAAGAAAACAGCTGG - Intronic
1041485224 8:58369244-58369266 GAGTTGAAAAGTAGGATAGGAGG + Intergenic
1042918384 8:73897494-73897516 CAGTTGGTCAAAAGGACAGGAGG + Intergenic
1043081166 8:75766760-75766782 GAGTTGAACAAGAGAACATATGG - Intergenic
1043860583 8:85311716-85311738 GAGTTGGACAAGATGGGAGGAGG - Intergenic
1044050199 8:87492464-87492486 GAGTTGAAAATGAGAACACGTGG - Intronic
1044444074 8:92253491-92253513 GAATTGAACAAGAGAACACTTGG + Intergenic
1046735007 8:117767584-117767606 ATGTTGGACAAGAGGACTGGTGG + Intergenic
1047724246 8:127670465-127670487 GAGTTGGGGAAGAGGAAAGGGGG - Intergenic
1047773688 8:128050842-128050864 GAATGGAACTTGAGGACAGGTGG - Intergenic
1050044855 9:1532379-1532401 GAGGTCAACAAGAGGACACATGG - Intergenic
1051862833 9:21646003-21646025 GAGTTGAACAAATGGACACAGGG - Intergenic
1052409101 9:28099843-28099865 GAGTTGAACAAGAGGACAGGAGG - Intronic
1054355286 9:64055342-64055364 GAGTGGATCACGAGGTCAGGAGG + Intergenic
1055544494 9:77354966-77354988 GAGATGAAGAAGAGGACTGCTGG - Intronic
1057453538 9:95187361-95187383 GAGATGAGCCAGAGGGCAGGAGG - Intronic
1057474715 9:95388663-95388685 GAGATGAGCCAGAGGGCAGGAGG + Intergenic
1058664240 9:107295409-107295431 GAGGCGAACCAGAGGACAGGTGG + Intronic
1058914210 9:109550015-109550037 GAGGAGAAAAAGAGGAGAGGAGG + Intergenic
1059788454 9:117613004-117613026 AAGTTGAACAAGAAGAAAGAAGG - Intergenic
1059826206 9:118031755-118031777 GAGGTGATAAAGAGGAAAGGAGG + Intergenic
1061602031 9:131676568-131676590 GAACAGAACAAGAGGACAGGAGG - Intronic
1186960326 X:14729637-14729659 GAGATGAACTAGAGGGCTGGAGG + Intronic
1187199454 X:17120917-17120939 GAGAAGAACCAGTGGACAGGTGG + Intronic
1187247753 X:17568139-17568161 TAGCTGACCAAGAGGCCAGGAGG - Intronic
1189569384 X:42279107-42279129 GATTTGTAGAAGAGGACAAGGGG + Intergenic
1196398445 X:115290037-115290059 GAGGAGAAAAAGAGGAGAGGAGG - Intronic
1196531394 X:116791135-116791157 GAGTTGAACATGAGAACACATGG + Intergenic
1196553697 X:117061447-117061469 GAGTTGAACATGAGAACACATGG - Intergenic
1197966002 X:132062425-132062447 GAGCTGAACAAGAGGAAATGGGG - Intergenic
1198783950 X:140267034-140267056 GAGTTGAACAAGAAAACACATGG - Intergenic
1200337085 X:155362196-155362218 GGGTTGAAGAACAGGAAAGGAGG + Intergenic
1200349385 X:155479031-155479053 GGGTTGAAGAACAGGAAAGGAGG - Intergenic