ID: 1052414111

View in Genome Browser
Species Human (GRCh38)
Location 9:28156314-28156336
Sequence AGTAACCCCATTCTAAGGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052414109_1052414111 10 Left 1052414109 9:28156281-28156303 CCTTTCAACAGAAATGTGACATA 0: 1
1: 0
2: 0
3: 23
4: 241
Right 1052414111 9:28156314-28156336 AGTAACCCCATTCTAAGGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052414111 Original CRISPR AGTAACCCCATTCTAAGGAA TGG Intronic
No off target data available for this crispr