ID: 1052414895

View in Genome Browser
Species Human (GRCh38)
Location 9:28165684-28165706
Sequence ATTTCCCTCTAGAGAAGCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052414893_1052414895 0 Left 1052414893 9:28165661-28165683 CCTGATTCCTTTTGAGCTGGTAT 0: 1
1: 0
2: 0
3: 7
4: 161
Right 1052414895 9:28165684-28165706 ATTTCCCTCTAGAGAAGCTAAGG No data
1052414890_1052414895 9 Left 1052414890 9:28165652-28165674 CCCTTTTTTCCTGATTCCTTTTG 0: 1
1: 2
2: 12
3: 134
4: 1300
Right 1052414895 9:28165684-28165706 ATTTCCCTCTAGAGAAGCTAAGG No data
1052414891_1052414895 8 Left 1052414891 9:28165653-28165675 CCTTTTTTCCTGATTCCTTTTGA 0: 1
1: 0
2: 4
3: 73
4: 798
Right 1052414895 9:28165684-28165706 ATTTCCCTCTAGAGAAGCTAAGG No data
1052414894_1052414895 -7 Left 1052414894 9:28165668-28165690 CCTTTTGAGCTGGTATATTTCCC 0: 1
1: 0
2: 0
3: 14
4: 168
Right 1052414895 9:28165684-28165706 ATTTCCCTCTAGAGAAGCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052414895 Original CRISPR ATTTCCCTCTAGAGAAGCTA AGG Intronic
No off target data available for this crispr