ID: 1052418026

View in Genome Browser
Species Human (GRCh38)
Location 9:28202657-28202679
Sequence AAGTCACATGATTTGAGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 160}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052418026_1052418028 -4 Left 1052418026 9:28202657-28202679 CCCTGGCTCAAATCATGTGACTT 0: 1
1: 0
2: 2
3: 14
4: 160
Right 1052418028 9:28202676-28202698 ACTTTGTTAACATATCACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052418026 Original CRISPR AAGTCACATGATTTGAGCCA GGG (reversed) Intronic
901528192 1:9837115-9837137 AAGCCACATGCTTTCGGCCAGGG + Intergenic
903321522 1:22546180-22546202 AAATGAGATGATTTGTGCCAAGG - Intergenic
906257248 1:44359686-44359708 GAGTCACAGGATTTGAGGTAAGG - Intergenic
908301377 1:62763860-62763882 AAGGCAGATCATTTGAGCCTAGG - Intergenic
912389341 1:109291318-109291340 AAGTCACATGATTCAAGGGAAGG + Intergenic
913110990 1:115656865-115656887 CTGTCACAAGATTTGACCCATGG + Intronic
913405819 1:118489510-118489532 ATGTCACATGAGTTGATCCGTGG - Intergenic
914673695 1:149891359-149891381 CAGCCACATGATTAGAGCCTAGG + Intronic
914933854 1:151960573-151960595 AACTCTGATGAATTGAGCCAGGG + Intergenic
918896964 1:190360696-190360718 AAGTCACATGTTTTCCACCAAGG - Intronic
919298259 1:195729347-195729369 TAGTAACATGCTGTGAGCCAAGG - Intergenic
919558669 1:199092807-199092829 CAGTCCCATGATCTGAGTCAAGG - Intergenic
922207277 1:223459460-223459482 TAGTCACCTGATCTGAGTCAAGG - Intergenic
922350505 1:224731358-224731380 AAATCACATGATCTGACACATGG - Intronic
923773099 1:236954952-236954974 AGGTCACATTAATTCAGCCAAGG + Intergenic
1063125212 10:3130921-3130943 ATGTCACATAATTAGTGCCAAGG - Intronic
1064481686 10:15746497-15746519 AAGTGAAAAGATTTGAACCAGGG - Intergenic
1066802412 10:39206374-39206396 AAGACACATGAGTGGAGCCAAGG + Intergenic
1068425195 10:56851546-56851568 AAGTCACTTGATATTAGACATGG + Intergenic
1068816277 10:61318230-61318252 TGGACACATGATTTGAGACATGG + Intergenic
1070388943 10:75951996-75952018 AAGTCATTAGATTTGAGCCATGG - Intronic
1072761663 10:98061884-98061906 AAGACAATAGATTTGAGCCATGG - Intergenic
1075068821 10:119307531-119307553 AAGGGCCATGAATTGAGCCAAGG + Intronic
1076152788 10:128176789-128176811 GAGTCACATGATCTCAGACAAGG - Intergenic
1076546669 10:131250037-131250059 AAGCCACACGATTTGAGTCACGG + Intronic
1080020116 11:27551421-27551443 AAGTCACATCAAGTGATCCATGG - Intergenic
1080080525 11:28213129-28213151 AAGTCTCAAGATTTGAGCCAAGG - Intronic
1080326674 11:31082393-31082415 AAGTCATATGATTTCAGAGAAGG - Intronic
1081915845 11:46729624-46729646 AAGTCACATGGCTTGAACCCAGG - Intronic
1086923497 11:92614996-92615018 TAGTCACATGATTTCAACAAAGG - Intronic
1087515912 11:99160752-99160774 AAGACACAGAATTTGACCCAAGG + Intronic
1087836893 11:102884510-102884532 AAGTGACTTGACTGGAGCCATGG + Intergenic
1088408613 11:109508549-109508571 AAGTTACCTGACTTCAGCCATGG - Intergenic
1088646897 11:111924671-111924693 AAGACACATGATCTCAGCCCTGG + Intronic
1093799103 12:23350373-23350395 AAATTACATTATTAGAGCCATGG + Intergenic
1094004071 12:25728490-25728512 AAGTGAAATGATGTGAGTCAAGG + Intergenic
1098245144 12:68509193-68509215 GAGTAAATTGATTTGAGCCAAGG - Intergenic
1098553048 12:71785750-71785772 AAGTCACATTATTTTACCAATGG + Exonic
1099620903 12:85001881-85001903 AAGTGGCATGATTTGAACCAAGG + Intergenic
1100503182 12:95194150-95194172 AAGGAACATCATTTGAGCCCAGG - Intronic
1100866449 12:98862604-98862626 AAGTTACATTATTTGAGCAAAGG - Intronic
1103411508 12:120715298-120715320 GAGTCACATTGTTGGAGCCAGGG + Intronic
1103663709 12:122543522-122543544 AAGTCACCTGTTTTGTGTCAAGG - Intronic
1103967917 12:124652052-124652074 AAGTCACATCCTTAGAGCCCTGG + Intergenic
1106852965 13:33815281-33815303 AGGTCACATGATTTATGACAAGG + Intergenic
1108372952 13:49789104-49789126 ATGTAACATGATTAGAGCAATGG - Intronic
1109827372 13:67739734-67739756 AGCTCACAGGATTAGAGCCATGG - Intergenic
1110617641 13:77558941-77558963 AAGTCTTTGGATTTGAGCCAAGG - Intronic
1111192495 13:84827963-84827985 AAGTGGGATGATTTGAGCCCAGG + Intergenic
1111790947 13:92853723-92853745 AAGTCTCATTATTTGAACAATGG - Intronic
1112192957 13:97195629-97195651 AATTAACATGATCTAAGCCATGG + Intergenic
1115161745 14:30404117-30404139 AAGTAACATTATTTGAGAAAAGG - Intergenic
1117484826 14:56184928-56184950 GAGTCACATGATTTGATGAATGG + Intronic
1118424518 14:65645071-65645093 AAGGCACGTAATTTCAGCCAAGG - Intronic
1121372652 14:93374543-93374565 AAGTCACTTTTTTTGAGACAGGG + Intronic
1121510253 14:94507002-94507024 AAGTCACCTGATATGTGACAAGG + Intronic
1121883218 14:97518835-97518857 AAGTCATAGGAATTGATCCAAGG + Intergenic
1124018722 15:25901107-25901129 ATGTGACATGGTTGGAGCCAAGG + Intergenic
1125505030 15:40262840-40262862 AACTGAAATGATCTGAGCCAGGG - Intronic
1127600349 15:60529717-60529739 AATTCACATTGTTTGTGCCATGG + Intronic
1129027460 15:72590859-72590881 AAGTCACCTGCCTTTAGCCATGG + Exonic
1129994167 15:79990535-79990557 AGGTCAAATGATTTGAGAAATGG - Intergenic
1132194752 15:99905359-99905381 ATGTCAAATGATTTGAACTATGG + Intergenic
1134227767 16:12404707-12404729 AGGTCACAGGATTTAAACCAGGG - Intronic
1135969214 16:27060225-27060247 TGGTCACAGGATTTGAACCACGG + Intergenic
1136666949 16:31820221-31820243 AAGTCCCAGGATTTGAGCGCAGG - Intergenic
1137832148 16:51554158-51554180 AAGACCCGTGATTTGAGTCATGG - Intergenic
1140024720 16:71275635-71275657 AAGTCACAAGATGTGAACCCGGG + Intergenic
1140891718 16:79290600-79290622 AAGTCACAAGATTTGGGCTGGGG + Intergenic
1143898729 17:10157131-10157153 CAGTCACAGGATTTGACACATGG + Intronic
1143982867 17:10885010-10885032 AAGTCTCAAGCATTGAGCCAAGG - Intergenic
1150720282 17:67608729-67608751 AAGGCACATCACTTGAGCCCAGG - Intronic
1153506974 18:5810761-5810783 AGGTAAAATGATCTGAGCCAAGG + Intergenic
1155394079 18:25367942-25367964 AAGTCCCATAATTAGAGCCCTGG - Intergenic
1157113333 18:44841543-44841565 GAGTCACATGAGTTTGGCCATGG - Intronic
1158719095 18:59908015-59908037 AAGTCACAGGATTTGAACTTGGG + Intergenic
1158852180 18:61505561-61505583 AAGGCAGATGATTTGAGCCCAGG - Intronic
1160055073 18:75471461-75471483 CACTCACATGATTTAAGCCATGG - Intergenic
1161110105 19:2464436-2464458 CAGGCAGATGACTTGAGCCAAGG - Intergenic
1163159303 19:15455298-15455320 AAGTCACTTGATTGAAGTCAGGG + Intronic
1166547462 19:43641770-43641792 AAGTCACAGAATGTGAGCCCTGG - Intergenic
1166630253 19:44400520-44400542 ACCTCACATGCTGTGAGCCAGGG - Intronic
1166637205 19:44460916-44460938 ACCTCACATGCTGTGAGCCAGGG + Intergenic
1167261857 19:48463219-48463241 AAGTCACTTTACTTGGGCCACGG - Intronic
924960151 2:27417-27439 TAGTCACATGGTTTGAAACATGG + Intergenic
929301680 2:40310551-40310573 AAGTCACATGGCCTGAGTCAGGG - Intronic
935686350 2:105687482-105687504 AAGGCACAAGGTTTGAGGCAGGG - Intergenic
938204328 2:129404513-129404535 AAGGCACAAGAGGTGAGCCATGG - Intergenic
938543510 2:132305984-132306006 ACCTCACATGCTGTGAGCCAGGG + Intergenic
940399691 2:153234032-153234054 AAGTCACATAATTTAAGCCATGG + Intergenic
940447650 2:153795473-153795495 AAATCACTTGATTTGGGCCCAGG - Intergenic
944572118 2:201055469-201055491 AAGCCAAATCATTTGAGCCCAGG + Intronic
945232008 2:207601338-207601360 AAGTCACATGATTTGAAGAGAGG - Exonic
946810925 2:223524970-223524992 AAATCACATGATTTTAGCCCAGG + Intergenic
1171872373 20:30538689-30538711 ACCTCACATGCTGTGAGCCAGGG + Intergenic
1175592181 20:60201977-60201999 AAATCAAATGATTTGACACATGG + Intergenic
1179551023 21:42144074-42144096 AAGTCAGATGATGACAGCCATGG + Intergenic
1180262185 21:46679519-46679541 TAGTCACATGGTTTGAAACATGG - Intergenic
949343967 3:3059445-3059467 AGGTTACATCATATGAGCCAAGG + Intergenic
951299112 3:20972788-20972810 AAGTCCCCTGATCTGAGTCATGG + Intergenic
951666550 3:25131219-25131241 AATTCACAAGCTTAGAGCCAAGG + Intergenic
952329958 3:32355716-32355738 AGGTCAGATGATATGAGCCCAGG - Intronic
952556022 3:34532279-34532301 AGGTCAGAGGATTTGGGCCATGG + Intergenic
953005153 3:38971046-38971068 ACGTCTCTGGATTTGAGCCACGG - Intergenic
957210639 3:77253596-77253618 AAATCATATGATTTGAGTGATGG + Intronic
957773716 3:84728574-84728596 AAGTCAAATCATTTTATCCATGG + Intergenic
959134224 3:102396877-102396899 AAGTTAAATGATTAGAGCCCTGG + Intronic
961441597 3:126956923-126956945 AAGTCACATGGTTATAGTCACGG + Intronic
963787906 3:149553802-149553824 AGTTCACATGAGTTAAGCCATGG - Intronic
963950969 3:151200295-151200317 AACTCACATGCTTAGAGCTAAGG + Intronic
964949824 3:162276546-162276568 AAGTCATATGAGCTGAGCCGCGG - Intergenic
967050643 3:185780890-185780912 GAATCACAAGATGTGAGCCAAGG - Intronic
967478546 3:189948094-189948116 AAGTCACAGGATTACAGCAAGGG + Intergenic
967577545 3:191112290-191112312 GAGTCACAGGAAATGAGCCATGG + Intergenic
968107932 3:196015521-196015543 CAGTCACATGGTTTGAAACATGG + Intergenic
970529667 4:16968818-16968840 AGGTCACATGAATTCAGCCTGGG - Intergenic
971484889 4:27148957-27148979 GAAACACATGATTTTAGCCAAGG - Intergenic
973176293 4:47210093-47210115 ATGACACATCATTTGAGTCATGG - Intronic
976095529 4:81504802-81504824 AAGTCACATGACAGTAGCCAGGG - Intronic
978195764 4:105970161-105970183 AAGTCCCATGCTTAGAGGCATGG + Intronic
978469332 4:109045953-109045975 AAGGAATATGATTTGACCCATGG + Intronic
979705259 4:123713263-123713285 AAGTCACATGATTGGAGTGTTGG + Intergenic
983294370 4:165847255-165847277 AAGGCAAATGATAAGAGCCATGG - Intergenic
983534575 4:168843754-168843776 CAGTCAAATGATGTCAGCCAAGG + Intronic
987005202 5:13703413-13703435 AAGAGACATGATTTGAACCTGGG + Intronic
987022241 5:13886576-13886598 AACTAACATGATTTGAGGCATGG + Intronic
990836653 5:60029180-60029202 AAGGTACATGATTTGAGTGATGG - Intronic
994097613 5:95861185-95861207 AATTCACATCATTTCAGCGATGG + Intergenic
994686877 5:102966722-102966744 AGTTAACATGATTAGAGCCATGG - Intronic
995547064 5:113243536-113243558 AAAGCACATAATCTGAGCCATGG + Intronic
996144359 5:119955512-119955534 AAATCACATGATTAGAGGGAGGG + Intergenic
999853623 5:155569636-155569658 ATGTCACATGGTCAGAGCCAGGG + Intergenic
1000937987 5:167326285-167326307 AAGTCACTGGATCTGAGGCATGG + Intronic
1001023148 5:168200693-168200715 AAGTCACATGCTATGTTCCAGGG + Intronic
1003625441 6:7737241-7737263 AAGTCAGATGTTATGAGACAAGG - Intronic
1004846035 6:19643307-19643329 AAGTCCCTTGATATGAGACATGG + Intergenic
1008780462 6:55097335-55097357 AAGTCAAATGATTTAAGATATGG - Intergenic
1010283419 6:74046400-74046422 CAGTCACTTTATTTTAGCCATGG + Intergenic
1010902451 6:81443264-81443286 GATTCCCATGATTTTAGCCAGGG - Intergenic
1013873134 6:114792593-114792615 AAGGAACATGATTGGACCCAGGG - Intergenic
1016579193 6:145609586-145609608 AAGTCAAATGGAATGAGCCATGG - Intronic
1018028127 6:159821470-159821492 AAGTAACTTGTTTTGAGACAGGG + Intergenic
1022125697 7:27354448-27354470 AAGTCTTTTGATTAGAGCCAGGG + Intergenic
1026301532 7:69102191-69102213 AAGTCAGATCGTTTGAGCCAAGG + Intergenic
1027417229 7:77986054-77986076 AAGTCACAGTATTTGGGCCCTGG + Intergenic
1031633565 7:124073990-124074012 AAGTCACTTGACTTATGCCATGG - Intergenic
1033487683 7:141807327-141807349 TGGTCAAATGATTTTAGCCAAGG + Intergenic
1033604559 7:142916642-142916664 AAAGCTGATGATTTGAGCCAGGG + Intronic
1034340455 7:150350373-150350395 AAGGCAGATCATTTGAGCCCAGG - Intergenic
1037370947 8:18178065-18178087 AGGTCACATGATTGGAGTCATGG + Intronic
1038854699 8:31318791-31318813 ATGTTACAAGATTTGAGCAATGG + Intergenic
1039008611 8:33068754-33068776 AGGTGACATCATTTGACCCATGG + Intergenic
1040079492 8:43272964-43272986 AGATAAAATGATTTGAGCCATGG - Intergenic
1040109142 8:43558556-43558578 ATGGCACATGAGTGGAGCCAGGG + Intergenic
1042740433 8:72037799-72037821 AAATCACATGATTTTAGGTAAGG - Intronic
1044742345 8:95341084-95341106 AAGTCACATTCTTTGTGCCTGGG + Intergenic
1049983882 9:930300-930322 AATTCAGATGACTTGAGCCAAGG - Intronic
1052418026 9:28202657-28202679 AAGTCACATGATTTGAGCCAGGG - Intronic
1052531087 9:29685249-29685271 AAGTTACATTTTTTGACCCAGGG - Intergenic
1054998711 9:71424070-71424092 AATTCAAATGATTTGAGCTTTGG - Intronic
1057480058 9:95438015-95438037 AAGTCAGAAGAATTGAGGCAAGG - Intergenic
1058237062 9:102503379-102503401 AACTCACATCCTTTGAGGCAAGG - Intergenic
1059345429 9:113624994-113625016 CAGTCTCATGAATGGAGCCAGGG + Intergenic
1060086008 9:120702322-120702344 AAGTCAGATGATATTACCCAGGG - Intronic
1062311856 9:135942557-135942579 AAGTAGCATCATTTGAGCCCAGG + Intronic
1186229037 X:7433086-7433108 AATACACATGATTTTAGACAGGG + Intergenic
1186594242 X:10963981-10964003 AAAACACATGATTTTAGCCATGG + Intergenic
1186638735 X:11432722-11432744 GAGACACATGATTTCAGCCAAGG - Intronic
1186837696 X:13453829-13453851 AAGTAAAATGTTTGGAGCCAAGG + Intergenic
1187030431 X:15482027-15482049 ATGTCACATGCTTTGACCAATGG - Intronic
1187391769 X:18890867-18890889 AATTCACCTGATGAGAGCCAGGG + Intergenic
1188846311 X:35076629-35076651 AAGTCTCATGATCTCACCCAAGG + Intergenic
1189622094 X:42852399-42852421 AAGTCTTATCATTTGAGTCAAGG + Intergenic
1192875685 X:75227130-75227152 AAATCACTTGACTTGGGCCATGG + Intergenic
1194020200 X:88680152-88680174 ATTTCAGATGATTTGAACCAAGG - Intergenic
1200846131 Y:7833738-7833760 AAGGCACATGAACAGAGCCATGG - Intergenic
1200892379 Y:8337662-8337684 GAGTCACATGATTTAGGTCATGG - Intergenic