ID: 1052418027

View in Genome Browser
Species Human (GRCh38)
Location 9:28202658-28202680
Sequence AAAGTCACATGATTTGAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 4, 3: 20, 4: 197}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052418027_1052418028 -5 Left 1052418027 9:28202658-28202680 CCTGGCTCAAATCATGTGACTTT 0: 1
1: 0
2: 4
3: 20
4: 197
Right 1052418028 9:28202676-28202698 ACTTTGTTAACATATCACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052418027 Original CRISPR AAAGTCACATGATTTGAGCC AGG (reversed) Intronic
901053185 1:6435977-6435999 AAAGGCACGGGACTTGAGCCAGG + Intronic
905305547 1:37015462-37015484 AAAATCTCAGGATTTGAGCAAGG + Intronic
906422120 1:45677783-45677805 ATAGTCTCATGATTTGATTCAGG - Intronic
907010249 1:50956651-50956673 TAAATTAAATGATTTGAGCCGGG + Intronic
907099641 1:51817760-51817782 AAAGTTAAATAATTTGGGCCTGG - Intronic
907915500 1:58865228-58865250 TAAGTCACATGTTCTGATCCTGG + Intergenic
912696746 1:111847876-111847898 AAGGTCACATCATTTGCCCCAGG + Intronic
912902615 1:113668875-113668897 AAAGTTACATGTTTTTGGCCGGG - Intronic
913137569 1:115907592-115907614 AAAGTCACATTACTAGAGCCAGG + Intergenic
914386658 1:147175873-147175895 AATGTCACATAAGTGGAGCCTGG - Intronic
914751097 1:150535538-150535560 AGAGTTAGAAGATTTGAGCCTGG - Intergenic
914933853 1:151960572-151960594 AAACTCTGATGAATTGAGCCAGG + Intergenic
919047555 1:192472594-192472616 AAAATAACGTGAATTGAGCCTGG - Intergenic
919277724 1:195443129-195443151 AATGGTAAATGATTTGAGCCTGG - Intergenic
920902269 1:210122271-210122293 AAAGTTTCAGGATTTGGGCCGGG - Intronic
921102531 1:211942290-211942312 AAAGTCACATGATTAGTGAACGG + Intronic
922061863 1:222100557-222100579 GGAGTGACATGATTTGAGCTGGG - Intergenic
923396945 1:233575155-233575177 AAAAACACATATTTTGAGCCGGG - Intergenic
1066071916 10:31825147-31825169 AAATCCACATGAATTGAGCACGG - Intronic
1066192254 10:33066808-33066830 AAAGTGATATGATTAGAGCTGGG - Intergenic
1066995886 10:42562624-42562646 AAAATCACAAGATTTAGGCCAGG - Intergenic
1070708656 10:78660434-78660456 AAAGTCAAATGGATTGGGCCAGG - Intergenic
1070957653 10:80474747-80474769 CAGGCCACATGGTTTGAGCCTGG + Intronic
1071107261 10:82112770-82112792 ATAGTCACCTGATTTTTGCCAGG + Intronic
1071157487 10:82707711-82707733 AAAATTACATGTTTTGAGCCAGG + Intronic
1072301024 10:94062435-94062457 AAAGTCTAATCATTTGAGCTGGG - Intronic
1072624133 10:97100081-97100103 GATGTCACACGATTTGAGTCAGG + Intronic
1072975578 10:100054652-100054674 ATAGTGACATGATTTGAGTCAGG - Intronic
1073888617 10:108070716-108070738 AAAGTTAAATGATTTGAGAGGGG - Intergenic
1074970076 10:118528832-118528854 AAAGTGACATGATTTGATCGAGG + Intergenic
1076007936 10:126963012-126963034 AAAGTCAAATGATTTCAACAAGG - Intronic
1077169547 11:1160089-1160111 AATGTCACCAGATTTCAGCCCGG - Intronic
1080703097 11:34661908-34661930 AGCCTCAGATGATTTGAGCCTGG - Intergenic
1083257860 11:61507832-61507854 AAAGAGACATGACTTGAGCTGGG - Intergenic
1085499542 11:77007136-77007158 AAAATCACATGTTTTGAGGTTGG + Intronic
1087027951 11:93670715-93670737 AAAGTGACATGATAAAAGCCAGG + Intronic
1091338208 11:134789359-134789381 ACAGTCCCCTGATTGGAGCCAGG - Intergenic
1091613402 12:2030847-2030869 AAAGTCACCTGAGGTGAGGCAGG + Intronic
1095238605 12:39830366-39830388 AAAGTGACATGCGCTGAGCCAGG + Intronic
1096058867 12:48679983-48680005 AAAGTCAAATGAGTTGACCTTGG - Intronic
1096153292 12:49328190-49328212 AAAGTGACATGATTTGACTTAGG + Intronic
1098432832 12:70438939-70438961 AAGGACACATTATCTGAGCCAGG - Intergenic
1098567402 12:71951728-71951750 AAAATGACATGATTTCGGCCGGG + Intronic
1098617725 12:72551202-72551224 TAAGTTACATGTTTTGAACCTGG + Intronic
1099209247 12:79764384-79764406 AAAGTCCCAGGATTGGGGCCTGG - Intergenic
1099960428 12:89391923-89391945 AAAGTCACATGACTTAAGAGAGG - Intergenic
1100059214 12:90552232-90552254 AAAATCACATGATCTGGGCTGGG - Intergenic
1100852542 12:98728422-98728444 AAAGTTACATAATTAGTGCCGGG + Intronic
1102202484 12:111067249-111067271 AGAGTCACATGACTTAAGCTGGG + Intronic
1102293528 12:111720734-111720756 AAAGACAGATGTTTTCAGCCTGG - Intronic
1102586736 12:113928844-113928866 TAAGTCACATGATTAGGACCTGG + Intronic
1102613460 12:114132692-114132714 AAAGTGACTTCATTTGAGCAGGG - Intergenic
1103712144 12:122920607-122920629 AAAGTCACATAAAGTGGGCCAGG + Intergenic
1103993359 12:124813956-124813978 CCAGTCACATCATTTGAGCCTGG + Intronic
1104749773 12:131230977-131230999 GAAGTCACTTGATTTGTTCCTGG + Intergenic
1108948057 13:56047424-56047446 AAAGTCACAAGGCTTGACCCTGG - Intergenic
1109329599 13:60912041-60912063 TAAGTCACTTTATCTGAGCCAGG - Intergenic
1111090680 13:83442009-83442031 AAATTCACATGATTTTACCTAGG + Intergenic
1111827361 13:93284291-93284313 ACATACACATGATTTGAGGCTGG - Intronic
1114466085 14:22923893-22923915 AAACTCATATGATGTGACCCAGG + Intronic
1116035754 14:39625414-39625436 GAAGCCACAGGAGTTGAGCCTGG - Intergenic
1117172214 14:53112443-53112465 AATGTGACATGAATTGAGCTAGG + Intronic
1117518547 14:56527302-56527324 AAAGGCAAAGGATTTGAGGCAGG + Intronic
1118071282 14:62249210-62249232 CAAGTCACATGATTAGAGAATGG + Intergenic
1118650666 14:67890293-67890315 AAAGTGACCTGATTTGCTCCAGG + Intronic
1119811001 14:77519328-77519350 AAAGCAACATAATTTGGGCCAGG - Intronic
1121372651 14:93374542-93374564 AAAGTCACTTTTTTTGAGACAGG + Intronic
1121566288 14:94912434-94912456 ACAGTCATATGTTTTGAGCTGGG - Intergenic
1121975410 14:98398994-98399016 AAAGTCCCATGGTTGGAGCACGG + Intergenic
1122164375 14:99810638-99810660 AAGGTCACGTGATTTGTCCCGGG - Intronic
1125604806 15:40934039-40934061 AAAGAAACATGATTTTAGGCTGG + Intronic
1126895799 15:53256022-53256044 AATGAGATATGATTTGAGCCTGG + Intergenic
1127327832 15:57912691-57912713 AAAGTCACAGGACTAGACCCAGG + Intergenic
1128298880 15:66551051-66551073 TAAGACACAAGATTTGGGCCAGG + Intronic
1129140424 15:73592935-73592957 AAAGTGAAATGATTTGTGCAAGG + Intronic
1131256211 15:90864281-90864303 AAAGACCCAGGATTTGAACCTGG - Intergenic
1131363685 15:91818752-91818774 CAAGTCACATGATGTGTGACTGG + Intergenic
1134227768 16:12404708-12404730 AAGGTCACAGGATTTAAACCAGG - Intronic
1134693661 16:16207294-16207316 ACAGGCACATGACTTGAGCCAGG + Intronic
1134813001 16:17183131-17183153 AACGTCACATGACTTGATCGTGG - Intronic
1134978184 16:18587349-18587371 AAAGGCACATGACTTGAGCCGGG - Intergenic
1136846721 16:33582109-33582131 AAACTCACAGGATTTAAGCAAGG - Intergenic
1137750859 16:50860068-50860090 AAAGTCACATGATCTGCCCTGGG - Intergenic
1138915211 16:61455444-61455466 AATGTCTCATGCTTTGACCCTGG - Intergenic
1140024719 16:71275634-71275656 AAAGTCACAAGATGTGAACCCGG + Intergenic
1140891717 16:79290599-79290621 AAAGTCACAAGATTTGGGCTGGG + Intergenic
1141548442 16:84787867-84787889 AAAGTCTCATTATTTCACCCAGG - Intergenic
1142348280 16:89568137-89568159 AAAGTCACATCATGTGTCCCGGG + Intergenic
1203108429 16_KI270728v1_random:1430764-1430786 AAACTCACAGGATTTAAGCAAGG - Intergenic
1144131799 17:12253608-12253630 AAAGTCACTCCATTTCAGCCTGG - Intergenic
1145055098 17:19697409-19697431 AAAGTCTCATGATGTCACCCAGG - Intronic
1145096839 17:20036423-20036445 AAAAACACATGATTTTGGCCAGG - Intronic
1148978984 17:51554636-51554658 AAAATGACATGATTTGGGCAGGG + Intergenic
1150187084 17:63194080-63194102 AAAGTCACAGAAGTTCAGCCAGG + Exonic
1151420917 17:73996899-73996921 AAATTAAGATGACTTGAGCCAGG + Intergenic
1151507507 17:74539323-74539345 ACAGTCCCATGATGTGAGTCGGG - Intergenic
1151509050 17:74547170-74547192 ATAGTCCCATGATGTGAGTCTGG - Intergenic
1155094070 18:22538999-22539021 AAAGTCACATGACTTGAAGGTGG + Intergenic
1157380196 18:47207425-47207447 GAAGTGGCAGGATTTGAGCCAGG - Intergenic
1158719094 18:59908014-59908036 AAAGTCACAGGATTTGAACTTGG + Intergenic
1160438191 18:78867257-78867279 ACAGTCTCATGAGCTGAGCCAGG - Intergenic
1163892015 19:20025380-20025402 AAATTAACATGAATTGGGCCAGG + Intronic
1167452857 19:49582462-49582484 AAAGTAAAATGAGTTGAGGCCGG + Intronic
925434512 2:3825340-3825362 GAAGGCACAGGATTCGAGCCTGG - Intronic
928261944 2:29775931-29775953 AAAGTCACATGACATAACCCAGG + Intronic
931274738 2:60734474-60734496 AAAGTCACTTGATGTTGGCCGGG + Intergenic
932096651 2:68855927-68855949 AAGTTCACATCATCTGAGCCTGG - Intergenic
935686351 2:105687483-105687505 AAAGGCACAAGGTTTGAGGCAGG - Intergenic
935843388 2:107138713-107138735 AAAGTCACATGATAGCAGCCAGG - Intergenic
937104325 2:119295741-119295763 AGAGTCACATGACTTCATCCGGG + Intergenic
940304099 2:152207161-152207183 AAAATCACAGGAATTCAGCCAGG - Intergenic
940979156 2:159981960-159981982 AAAGTCATATAATATGAGCCAGG - Intronic
943830855 2:192459776-192459798 ATAGGGATATGATTTGAGCCCGG - Intergenic
945010645 2:205459481-205459503 AAAGTAACATGAATAGGGCCTGG + Intronic
945844923 2:214932245-214932267 AAAGTCAGATGGTTTGTGGCAGG - Exonic
946942176 2:224780923-224780945 AAAGTCACAGGTTATGAGCAAGG - Intronic
1170798673 20:19572039-19572061 AAAGGTACATGACCTGAGCCAGG + Intronic
1171338291 20:24407853-24407875 TAAGTCAAATGATTTGTGCAAGG - Intergenic
1174616466 20:51839242-51839264 AAATTCAAATGATTTAGGCCGGG - Intergenic
1175576384 20:60063801-60063823 AAAGTCACAAGAAATGAGGCTGG + Intronic
1179227156 21:39464516-39464538 AAAGTGACTTTATTTGGGCCGGG - Intronic
1182023989 22:27103016-27103038 AAATTCACATGAGGTGAGCAGGG + Intergenic
1182438516 22:30347080-30347102 AAATTTAGTTGATTTGAGCCTGG + Intronic
1182839043 22:33369862-33369884 AAAGTCAACTGATTTAGGCCAGG - Intronic
1184672308 22:46021066-46021088 AAAGTCAAAGGATGTGAGACTGG - Intergenic
949495555 3:4628310-4628332 AAAGCCACATGAATGGTGCCTGG + Intronic
949648179 3:6122990-6123012 AAAGCAACAAAATTTGAGCCAGG - Intergenic
951375624 3:21912516-21912538 AAACTGACATGCTTTGAACCAGG + Intronic
953062028 3:39435252-39435274 AAATTCACAGGATCTGAGTCAGG + Intergenic
954307549 3:49737388-49737410 CAAGACACATAATTTGAGGCTGG + Intronic
955156403 3:56421022-56421044 AAAATAACATGAATTGATCCTGG + Intronic
957156130 3:76547339-76547361 AAAGTCACATGTTTTTATCAGGG - Intronic
959579435 3:107968621-107968643 GAGGTCACAGGACTTGAGCCTGG + Intergenic
959965803 3:112353559-112353581 AAAGTCACATGCTGTTATCCAGG - Intronic
960273690 3:115702092-115702114 AAAGACATAGGATTGGAGCCAGG + Intronic
961789655 3:129366448-129366470 TGAGTCACTTGCTTTGAGCCCGG + Intergenic
963138117 3:141926096-141926118 AAAGTCACTTGATGTTGGCCGGG - Exonic
963322799 3:143827779-143827801 AAAGTTACATGATTTGAAAATGG - Intronic
963344407 3:144076969-144076991 AAATTCACGTTATTTGAGTCTGG + Intergenic
963590752 3:147255416-147255438 TAAGTCACATGACTTAAGCATGG - Intergenic
966624569 3:182002167-182002189 AAAGTCACATACTTGAAGCCAGG + Intergenic
967662932 3:192135310-192135332 ACAGTCACTTGTTTCGAGCCAGG + Intergenic
968191578 3:196671977-196671999 AATGTCACATGCTTTCGGCCGGG + Intronic
969888152 4:10235100-10235122 AAAGTCAGATGAACTGAGCCTGG + Intergenic
970529668 4:16968819-16968841 TAGGTCACATGAATTCAGCCTGG - Intergenic
973067564 4:45816053-45816075 AAAGACTCTTGATTTCAGCCTGG - Intergenic
975208249 4:71668777-71668799 AGGGTCACATGATTTGAGAAAGG - Intergenic
977172332 4:93778692-93778714 AAAGTCAAATGATATAAGACTGG - Intergenic
977340189 4:95748257-95748279 AAACTCACATTATTTGTTCCTGG - Intergenic
977880130 4:102194765-102194787 AAAATCACATGAATTGAAGCAGG + Intergenic
982890796 4:160847564-160847586 AAACTCACATTGTTTGAGCATGG - Intergenic
984026170 4:174546312-174546334 AAAGTCAAATGATATGAGGCAGG + Intergenic
987005201 5:13703412-13703434 TAAGAGACATGATTTGAACCTGG + Intronic
987370817 5:17191345-17191367 AAAGTCAAGTGATTCGAGCCAGG + Intronic
988414190 5:30925249-30925271 TAAGTTACATGAAATGAGCCAGG + Intergenic
995151308 5:108849894-108849916 AAAATCACATTATTAGGGCCAGG + Intronic
995738658 5:115330851-115330873 AAATTCTGAGGATTTGAGCCTGG - Intergenic
996144358 5:119955511-119955533 AAAATCACATGATTAGAGGGAGG + Intergenic
996916930 5:128723238-128723260 TAAGTCACAGAATTTGAGCAGGG + Intronic
996974013 5:129408678-129408700 ATAGTGACATCATTTGGGCCAGG - Intergenic
998969518 5:147576208-147576230 GAAGTCAGATGATCTGACCCAGG + Intergenic
1000113712 5:158133952-158133974 GAAGGCACATGATCTAAGCCGGG + Intergenic
1000178969 5:158788680-158788702 AAAGTCACATGACTGCAGCCAGG + Intronic
1001023147 5:168200692-168200714 AAAGTCACATGCTATGTTCCAGG + Intronic
1001330013 5:170755161-170755183 TACATCACATGGTTTGAGCCAGG - Intergenic
1002201954 5:177533978-177534000 AACATCCCATAATTTGAGCCAGG + Intronic
1003942266 6:11042012-11042034 AAAGTAATACGATTTCAGCCGGG + Intronic
1003948816 6:11099163-11099185 AAAGTCTGATGCATTGAGCCTGG - Intronic
1004553006 6:16667887-16667909 AAAGACAAATGTCTTGAGCCGGG - Intronic
1005218986 6:23564353-23564375 AAAGCCACATGGTGTGAGCCAGG - Intergenic
1005463646 6:26091482-26091504 AAAGGCACAAGATTCGGGCCAGG + Exonic
1009549288 6:65066095-65066117 AAAGCCACAGCATCTGAGCCTGG + Intronic
1010902452 6:81443265-81443287 AGATTCCCATGATTTTAGCCAGG - Intergenic
1011265593 6:85514967-85514989 AAACTAACATGATTTAGGCCAGG + Intronic
1013298757 6:108783105-108783127 AAAGTTATATGCTTTGAGCTTGG + Intergenic
1013459354 6:110359722-110359744 ATAGTCACAGGATGTGAGGCTGG - Intergenic
1013873135 6:114792594-114792616 AAAGGAACATGATTGGACCCAGG - Intergenic
1014148042 6:118021082-118021104 AAAGGCACAAGAATAGAGCCTGG + Intronic
1015195224 6:130518297-130518319 AAACTCACTGGACTTGAGCCTGG - Intergenic
1017674586 6:156799772-156799794 AATATCAAATGATTTGAGGCCGG - Intronic
1017754826 6:157520409-157520431 AAATTCACATAATTTGAGACTGG + Intronic
1018028126 6:159821469-159821491 AAAGTAACTTGTTTTGAGACAGG + Intergenic
1018196966 6:161363861-161363883 AAAGAAACATGATTTGGGGCCGG + Intronic
1019184192 6:170211595-170211617 GAAGTCACATGACTTGTGCCTGG + Intergenic
1020059500 7:5141652-5141674 AATGTCTCATGATTTGATTCAGG + Intergenic
1022997789 7:35775618-35775640 AGTGTAAAATGATTTGAGCCTGG + Intergenic
1024053414 7:45644486-45644508 AAAGTCTCCTGATTTGCTCCAGG - Intronic
1026193332 7:68149674-68149696 AAGGTCACATGATTTTGGCCAGG - Intergenic
1028078279 7:86542456-86542478 ATAGTCACATGATTAAAGCTGGG - Intergenic
1030723042 7:112892471-112892493 TAAATAACATGACTTGAGCCAGG + Intronic
1032391637 7:131558631-131558653 AAATTCACATGATTTGGGATTGG + Intergenic
1032834939 7:135663637-135663659 AAAGATACAGCATTTGAGCCGGG - Intronic
1037021093 8:13971652-13971674 AAAGTCTAATGATTTTAGCTTGG + Intergenic
1037433694 8:18841076-18841098 AAAGTCCCATGATTTCAGTTGGG + Intronic
1040109141 8:43558555-43558577 AATGGCACATGAGTGGAGCCAGG + Intergenic
1041701767 8:60798084-60798106 AAGGTCACATGATAAGAGTCGGG + Intronic
1044742344 8:95341083-95341105 CAAGTCACATTCTTTGTGCCTGG + Intergenic
1045671739 8:104562093-104562115 AAAGTCACACAGTTAGAGCCAGG - Intronic
1047526024 8:125634780-125634802 AAAGACACAGGCTTTGAGGCTGG + Intergenic
1047526260 8:125636942-125636964 AAAGACACAGGCTTTGAGGCCGG + Intergenic
1048539413 8:135328902-135328924 AAAGTCACATGACTTGTCCATGG + Intergenic
1048773169 8:137917464-137917486 TAATTGACATGATTTGAGGCTGG - Intergenic
1051438689 9:17059130-17059152 AAATACAAATGATTTCAGCCAGG - Intergenic
1052355419 9:27500145-27500167 AAATTCACTTGAATTGAGTCTGG + Intronic
1052418027 9:28202658-28202680 AAAGTCACATGATTTGAGCCAGG - Intronic
1052531088 9:29685250-29685272 AAAGTTACATTTTTTGACCCAGG - Intergenic
1052745882 9:32440643-32440665 AAAGCAACAGGATTTGTGCCTGG - Intronic
1058802960 9:108562578-108562600 ACAGTCACATGATCTCATCCTGG + Intergenic
1059008469 9:110430306-110430328 AAAATCACATGTTTGGAGTCTGG - Exonic
1060246494 9:121950825-121950847 ACAGAGTCATGATTTGAGCCAGG - Intronic
1190371995 X:49751681-49751703 CAAGTCACATACTTTGATCCAGG - Intergenic
1190950244 X:55136463-55136485 ATAGTGACATGAGATGAGCCTGG + Intronic
1191606727 X:63070857-63070879 AAAGTCACATGACTGCAGCCAGG - Intergenic
1194152865 X:90347100-90347122 GAAGTCACATCATTTAGGCCAGG + Intergenic
1195227184 X:102809159-102809181 GAAGTCACATGAATTCATCCAGG - Intergenic
1200499209 Y:3923913-3923935 GAAGTCACATCATTTAGGCCAGG + Intergenic
1201858710 Y:18572316-18572338 AAACTTACATGATGTGAACCAGG - Intronic
1201874611 Y:18748065-18748087 AAACTTACATGATGTGAACCAGG + Intronic
1202106794 Y:21379298-21379320 CAAGGCACATAATTTGAGACAGG + Intergenic
1202233406 Y:22679637-22679659 CAAGTCACATAATTTGAGCCAGG - Intergenic
1202309750 Y:23516521-23516543 CAAGTCACATAATTTGAGCCAGG + Intergenic
1202561051 Y:26154072-26154094 CAAGTCACATAATTTGAGCCAGG - Intergenic