ID: 1052418027

View in Genome Browser
Species Human (GRCh38)
Location 9:28202658-28202680
Sequence AAAGTCACATGATTTGAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052418027_1052418028 -5 Left 1052418027 9:28202658-28202680 CCTGGCTCAAATCATGTGACTTT No data
Right 1052418028 9:28202676-28202698 ACTTTGTTAACATATCACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052418027 Original CRISPR AAAGTCACATGATTTGAGCC AGG (reversed) Intronic