ID: 1052418028

View in Genome Browser
Species Human (GRCh38)
Location 9:28202676-28202698
Sequence ACTTTGTTAACATATCACCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052418026_1052418028 -4 Left 1052418026 9:28202657-28202679 CCCTGGCTCAAATCATGTGACTT 0: 1
1: 0
2: 2
3: 14
4: 160
Right 1052418028 9:28202676-28202698 ACTTTGTTAACATATCACCTTGG No data
1052418027_1052418028 -5 Left 1052418027 9:28202658-28202680 CCTGGCTCAAATCATGTGACTTT 0: 1
1: 0
2: 4
3: 20
4: 197
Right 1052418028 9:28202676-28202698 ACTTTGTTAACATATCACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052418028 Original CRISPR ACTTTGTTAACATATCACCT TGG Intronic
No off target data available for this crispr