ID: 1052421501

View in Genome Browser
Species Human (GRCh38)
Location 9:28248485-28248507
Sequence AAGGATATGCAGATTGTTGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052421495_1052421501 11 Left 1052421495 9:28248451-28248473 CCAGTGGTTGGAATGGGTCATAG 0: 1
1: 0
2: 2
3: 6
4: 88
Right 1052421501 9:28248485-28248507 AAGGATATGCAGATTGTTGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052421501 Original CRISPR AAGGATATGCAGATTGTTGA CGG Intronic
No off target data available for this crispr