ID: 1052422495

View in Genome Browser
Species Human (GRCh38)
Location 9:28261307-28261329
Sequence GGCTGCAAAAAGAGTAAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 176}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052422495_1052422497 -4 Left 1052422495 9:28261307-28261329 CCCAGCTTACTCTTTTTGCAGCC 0: 1
1: 0
2: 1
3: 12
4: 176
Right 1052422497 9:28261326-28261348 AGCCATGCTTAAATTCAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052422495 Original CRISPR GGCTGCAAAAAGAGTAAGCT GGG (reversed) Intronic
905231603 1:36517926-36517948 GGCCACAAAAAGAGTAAACAAGG + Intergenic
905884744 1:41485578-41485600 GTCTGCAAAAGAAGTAAGCCAGG + Intergenic
906980358 1:50622364-50622386 GGCTGAAAAGGGAGGAAGCTGGG - Intronic
909097732 1:71309569-71309591 GGCTTCGTAAAGAGTCAGCTTGG - Intergenic
910348626 1:86270184-86270206 GGCTGCACAAAGAATCACCTGGG - Intergenic
912264950 1:108148029-108148051 GGCAGCAACATGAGTGAGCTTGG + Intronic
913095099 1:115509228-115509250 GTCTGAAAAAAGAGTCAGCAAGG + Intergenic
913395308 1:118363677-118363699 GGCTGGAAAAAAAATAAGATGGG - Intergenic
915049054 1:153048962-153048984 GGCTGAAAAGAGAGAAAGGTGGG + Intergenic
915051805 1:153083594-153083616 GGCTGAAAAGAGAGAAAGCTGGG + Intergenic
915053397 1:153102575-153102597 GGCTGAAAAGAGAGAAAGTTAGG + Intronic
916881472 1:169023361-169023383 GGATGCAAAAAGAGATAGCAGGG - Intergenic
918777282 1:188650101-188650123 GGCTCCAAAAAGGGTTAACTTGG - Intergenic
919404192 1:197155922-197155944 GGCTGCAAAAAAAATAGGTTGGG + Exonic
919433098 1:197521588-197521610 GGCTGCAAAATACATAAGCTTGG - Intronic
920762852 1:208802360-208802382 GGCTGCTAAAAGAGGAGGCATGG - Intergenic
920986414 1:210894537-210894559 GGCTGCACAAAGAGAAAACTAGG - Intronic
1066280135 10:33909135-33909157 AGCTGCAAAGAGAGAAAACTCGG - Intergenic
1069036678 10:63652762-63652784 GGCTGCCAATAGAATAATCTAGG - Intergenic
1069688241 10:70333162-70333184 GGTTGCAAGAAGTGTTAGCTTGG + Intronic
1071528101 10:86369857-86369879 GGGTGCAAAAAGATAAAACTGGG + Intergenic
1074344261 10:112666740-112666762 GGCTACAACAAGACTAAGATAGG + Intronic
1076059249 10:127400675-127400697 GGCTGGACATAGAGTAAGCTGGG + Intronic
1080088974 11:28321066-28321088 GGCTGAAAGTAGAATAAGCTTGG + Intronic
1081458426 11:43248152-43248174 GGCTGCAGAAAGATTAATTTGGG - Intergenic
1082958044 11:58892775-58892797 GCCTGCAATAAAAGCAAGCTTGG + Intronic
1083032784 11:59609154-59609176 AGTTGCAAAAATAGTTAGCTTGG - Intronic
1084040962 11:66542534-66542556 GGCAGCAGAAAGAGGAAGATGGG + Intronic
1085196151 11:74673022-74673044 GGCTGCAAAAGGAAGCAGCTGGG - Intergenic
1086362684 11:86075247-86075269 GGCTACAAAAACAATAATCTGGG + Intergenic
1086865668 11:91976877-91976899 GGCTTTAAAAAGAGAAAGATGGG - Intergenic
1087667434 11:101066909-101066931 GTCTACAAAAAGTGAAAGCTGGG - Intronic
1089208714 11:116786501-116786523 GCCTGCACGAAGGGTAAGCTGGG - Exonic
1089414864 11:118279425-118279447 GGCTGAAAACAGAGGAAGGTGGG - Intergenic
1091109547 11:132953090-132953112 GGAAGGAAAAAGAGTAGGCTAGG - Intronic
1091273570 11:134334222-134334244 GGCTCCACAAAGAGTGAACTTGG - Intronic
1097916277 12:65023566-65023588 TGCTGCAAAAAGATTAGTCTGGG - Intergenic
1098984930 12:77001770-77001792 GGCTGCAAAAGGACTAGGCAAGG + Intergenic
1099373473 12:81866468-81866490 GGCTGAAGAGAGAGGAAGCTGGG - Intergenic
1100196109 12:92247256-92247278 GGCTGGAAAAAAACTAAGCATGG - Intergenic
1102017105 12:109655390-109655412 GGCTCCAGAAAGAGTCAGATGGG - Intergenic
1102828156 12:115968459-115968481 GGCTGCAAAATGACTAAGCCAGG + Intronic
1104459250 12:128941126-128941148 GGCAGCAACAAGGGTGAGCTTGG - Intronic
1106502345 13:30340946-30340968 GGCTGCAGAAAGTCTATGCTGGG + Intergenic
1107500690 13:40971756-40971778 GGCTACAAAAAGAAGAATCTAGG - Intronic
1108179633 13:47828043-47828065 GGCTACACACAGAATAAGCTAGG + Intergenic
1109916702 13:68997058-68997080 TGCTGCAAAAAAAGTAATTTGGG + Intergenic
1113265327 13:108610094-108610116 GGTTGAAGAAAGAGTAAGCCTGG - Intronic
1113578988 13:111414660-111414682 GTCTGGAAAAAGACTCAGCTAGG + Intergenic
1114262520 14:21048270-21048292 GACTCCAAAACCAGTAAGCTTGG + Intronic
1114969400 14:28006232-28006254 GGCTGAAAGGAGAGGAAGCTGGG - Intergenic
1117384653 14:55199077-55199099 GGCTACAAAAAAGGTAAGGTAGG + Intergenic
1119070092 14:71574141-71574163 TGCTGTAAAAAGAATAAGGTGGG + Intronic
1119972013 14:78981392-78981414 GGCTGCACAATTAGCAAGCTTGG + Intronic
1120771608 14:88385800-88385822 GGCTGCAAGAGGACTAAGCATGG + Exonic
1120801275 14:88691296-88691318 GGGTGCAAACAGGGTAAGCAGGG + Intronic
1121287164 14:92745237-92745259 GGTTTCAAAAATAGTAAGTTGGG - Intronic
1124055396 15:26237177-26237199 GGCTGCAAAAAGTTTAGGATGGG + Intergenic
1126490052 15:49226365-49226387 GGCTGAAAAGAGAAGAAGCTGGG - Intronic
1127021761 15:54756293-54756315 GGCTGAAGGAAGAGGAAGCTGGG + Intergenic
1127266294 15:57365102-57365124 GGCTGCAATTAGAGTCACCTGGG + Intergenic
1128151300 15:65365102-65365124 GTCTGTAAAATGAGAAAGCTGGG + Intronic
1128819227 15:70637216-70637238 GGCTGTCAAAAGAGAAAGTTAGG + Intergenic
1129223651 15:74151612-74151634 GGCTGAAAAAAGAATAGGCCAGG - Intergenic
1137826347 16:51499288-51499310 ATCTGCAAAAGGAGTAAACTTGG - Intergenic
1140245904 16:73249231-73249253 GGCTTCAAAGAAAGTAAGTTAGG - Intergenic
1146712929 17:35058357-35058379 GGCTGCATATAGAGTCATCTGGG - Intronic
1147026760 17:37592742-37592764 GAATGCAAAAGGAGTAAGGTGGG + Intronic
1149383291 17:56116119-56116141 AGCTGAAAAAAGAGGATGCTCGG - Intronic
1150817573 17:68405419-68405441 GGCATCAAAAAGAGTAAAATAGG - Intronic
1155263351 18:24066867-24066889 GGCTGGAGAGAGAGGAAGCTAGG - Intronic
1156288213 18:35721111-35721133 GGCTGAAGAGAGAGGAAGCTGGG + Intergenic
1156331575 18:36128975-36128997 GGCTACAGAAAGAGGATGCTGGG - Intronic
1156424705 18:36997742-36997764 GGCTGTAAAATGAGCAATCTGGG + Intronic
1157905913 18:51570147-51570169 GTCTGAAAAAAGAGTCAGCAAGG + Intergenic
1158640046 18:59195978-59196000 AGCTCCAAAATGAGGAAGCTGGG - Intergenic
1159025273 18:63177803-63177825 GACTGCAAACAGAGTCAGCTTGG - Intronic
1161285035 19:3464359-3464381 CGCTCCAAAAACACTAAGCTGGG + Intronic
1163313378 19:16527161-16527183 GTCTGCAAAAAGACTGAGCCTGG + Intronic
1166641243 19:44497195-44497217 GGCTGCAAAGAGAGTCAGGGAGG + Intronic
927842103 2:26451509-26451531 GCCTGTAAAAAGAGTTGGCTGGG + Intronic
928818565 2:35330492-35330514 GGATCCAAAAAGAGAAAGCCAGG + Intergenic
929605843 2:43233657-43233679 GGGTGCAGAAAGAGGAAGCAGGG + Intronic
933399006 2:81767342-81767364 GGCTGAAAAATGACTAAGCTTGG + Intergenic
935492134 2:103734087-103734109 GGCTGAAGGAAGAGGAAGCTGGG - Intergenic
941370175 2:164655295-164655317 GGCTGCCAAAAGATGAAGCCAGG + Intronic
941442138 2:165551601-165551623 CGCTGCTAAAATAGAAAGCTGGG + Intronic
945295994 2:208171978-208172000 GCCCGCAAACAGAGTAAGCCTGG - Exonic
945454009 2:210028007-210028029 GGCTGCAAACAGAGACAGGTGGG - Intronic
945487744 2:210417464-210417486 GGCTGAAGGAAGAGGAAGCTAGG - Intergenic
946040666 2:216780696-216780718 AGAGGCAAAAAGAGTAAGTTAGG + Intergenic
946105266 2:217363628-217363650 GGCTGCAAAAAGGGGAAGCTGGG + Intronic
946266491 2:218547067-218547089 TTCTGCAAAAAGAGGAAGTTTGG - Exonic
947041398 2:225925011-225925033 GGCTGCAAAAAGGATTATCTGGG + Intergenic
948672252 2:239576032-239576054 GGCTGGAAACAGAGGGAGCTTGG + Intergenic
1170055489 20:12198510-12198532 CTCTGCAAAAAGAACAAGCTTGG - Intergenic
1174125032 20:48298072-48298094 GGCTGCAAACAGTATCAGCTGGG + Intergenic
1175586936 20:60148635-60148657 GGCAGCATAAAGAGTAAGCATGG + Intergenic
1175899249 20:62353566-62353588 GGCTGCAGATGGAGCAAGCTAGG + Intronic
1179124694 21:38580252-38580274 GGCTGCAAAAAGAGTCAGAGAGG - Intronic
1180248185 21:46562379-46562401 GGCAGCATGAAGAGTAAGCCAGG + Intronic
950690137 3:14649227-14649249 GCCTGCAAAATGAGTGAGCCTGG + Intergenic
952086191 3:29824418-29824440 GGCTGCTATAACAATAAGCTGGG - Intronic
952783571 3:37129427-37129449 TTCTGGAAAAAGAGTAAGTTTGG - Intronic
953247989 3:41213861-41213883 GATTACAGAAAGAGTAAGCTAGG - Intronic
955613974 3:60785698-60785720 GGTGGCAAAAAGAGTATCCTGGG + Intronic
957655756 3:83072519-83072541 GGCTGCAAAAAAAGCAAGAAGGG + Intergenic
957972232 3:87397036-87397058 AGATGCTAAAAGGGTAAGCTAGG + Intergenic
958537242 3:95418989-95419011 GGCTGAAAGAAGAGGAAGCTGGG - Intergenic
960538953 3:118843791-118843813 AGCTGCAAAAAAAGGGAGCTGGG - Intergenic
961093541 3:124136145-124136167 GGCTGCAATTAAAATAAGCTGGG - Intronic
962458938 3:135591288-135591310 GGCTGCAAAAAGACTGAGGAAGG - Intergenic
965474746 3:169142188-169142210 GGCTGCAAATAGACTTAGATTGG + Intronic
965623120 3:170660288-170660310 GGCTGTAATAAGAGTAAGGAAGG - Intronic
967792701 3:193566195-193566217 GGTAGCAAAAAGAGTAGGTTAGG - Intronic
968453452 4:685922-685944 GGATGCACAAAGTGTCAGCTCGG + Intronic
972759172 4:42085069-42085091 AGCTGCAAAAAGGGTAGGGTTGG - Intronic
975077130 4:70224323-70224345 AGAGGGAAAAAGAGTAAGCTAGG + Intergenic
975349852 4:73333074-73333096 CACTGCAAAAAGAATAATCTAGG - Intergenic
975677611 4:76842621-76842643 AGCCTCAAAAAGACTAAGCTAGG - Intergenic
976661990 4:87549380-87549402 TGCTGCAAAAACACTAAGGTTGG + Intergenic
979829605 4:125283038-125283060 AGCTGAAAGAAGAGTAATCTAGG - Intergenic
981401749 4:144321818-144321840 GGCTGAAAGAAGAGGAAGCTTGG + Intergenic
981466188 4:145075576-145075598 GGCTGAAAGGGGAGTAAGCTAGG + Intronic
982472833 4:155814737-155814759 AAGTGCAAAAAGAGTAAGTTGGG - Intergenic
982629835 4:157818960-157818982 GGCTGAAGAAGGAGAAAGCTTGG + Intergenic
986127200 5:4894095-4894117 GGATGCACAGGGAGTAAGCTAGG + Intergenic
986852622 5:11830725-11830747 GGCTGAAAATGGAGGAAGCTGGG + Intronic
988915307 5:35887591-35887613 TGCTGTAAAAAGAGGCAGCTGGG - Intergenic
990840906 5:60077943-60077965 GGCTGCAGAGGGAGGAAGCTGGG - Intronic
998251484 5:140556469-140556491 AGCTGCAAAAGGAATAAGTTTGG - Intronic
999494523 5:152084058-152084080 GGCTGCAATAAGAGCAAGGAGGG - Intergenic
999734125 5:154499885-154499907 ACCTGCAAAAAGTGCAAGCTGGG - Intergenic
1004012931 6:11706404-11706426 AGCTGCTAACAGAGGAAGCTGGG + Intergenic
1004357041 6:14938920-14938942 GGCAGAAAAAAGAGTAACTTTGG - Intergenic
1006417143 6:33911348-33911370 GGCTGCAAAAAAAGTGGACTGGG - Intergenic
1007695890 6:43734160-43734182 GGGGGCAAGAAGGGTAAGCTGGG - Intergenic
1010682156 6:78809533-78809555 GGCTGAAAAAGGAGGAATCTGGG - Intergenic
1010885895 6:81240204-81240226 GGTTGTAAAAAGAGTAAACTTGG + Intergenic
1011765525 6:90615520-90615542 GGCTGCAATAACAGTAGGGTTGG + Intergenic
1014454028 6:121616145-121616167 GGCTGAAAAAAGAATAAGTAAGG + Intergenic
1015406110 6:132838160-132838182 GTTTACAAAAAGAGTAAGCAGGG - Intergenic
1015565548 6:134566887-134566909 CGCTGCAGAAAGACAAAGCTTGG + Intergenic
1015770085 6:136759827-136759849 GTCTGAAAAAAGAGTCAGCAAGG + Intronic
1016278067 6:142378675-142378697 GAATGCAAGAAGAGGAAGCTTGG - Intronic
1018875888 6:167822205-167822227 GGCTGGAACAGGAGGAAGCTGGG + Intergenic
1019056945 6:169230758-169230780 GGCTTCAAGAAGGGTAGGCTGGG + Intronic
1020706038 7:11545557-11545579 GGCTAAAAGAAGAGGAAGCTGGG + Intronic
1021171372 7:17401900-17401922 GGCTATAAAAAGACTACGCTTGG + Intergenic
1021200182 7:17720176-17720198 GGCAGCAAAAAGAGTAATGATGG + Intergenic
1024980487 7:55153892-55153914 GGCTGCAAAGACAGTAACTTGGG + Intronic
1028791433 7:94857823-94857845 GGATGCTAAATGAGTAAGCATGG - Intergenic
1030106415 7:105990989-105991011 GGCGGCAAATAGAGAAACCTGGG + Intronic
1031662671 7:124445571-124445593 GGCTGCAACAGGAGAAATCTGGG - Intergenic
1033012089 7:137633670-137633692 GGCTGCAAATAGAGTGTACTGGG - Intronic
1034455037 7:151165469-151165491 GGCAGAAAAAAGAGTAAGACAGG - Intronic
1037499321 8:19470216-19470238 GGATACAAATAGAGAAAGCTTGG + Intronic
1039390658 8:37178658-37178680 GGCTGCAAAAAGTGAAGGCGAGG + Intergenic
1039478706 8:37855896-37855918 TGCTTCAAAAAAAGTCAGCTGGG - Intergenic
1041044026 8:53875071-53875093 GACTGCAAGAGGAGAAAGCTCGG + Intronic
1041871881 8:62644079-62644101 GGTTTCATAAAGAGTAAGCTGGG - Intronic
1043593997 8:81863568-81863590 AGCTGAAGAAAGAGGAAGCTGGG + Intergenic
1047711813 8:127559963-127559985 GGATACAAAAAGAGCAAGATAGG - Intergenic
1050056947 9:1665747-1665769 GGCTGCAGAAATAATAAGCCAGG - Intergenic
1052257161 9:26471298-26471320 GGCTCCAAAGAGAGTCAGCAAGG + Intergenic
1052422495 9:28261307-28261329 GGCTGCAAAAAGAGTAAGCTGGG - Intronic
1052649172 9:31277893-31277915 AGCTGAAAAAAAAGTAAGCAGGG + Intergenic
1054968795 9:71060824-71060846 GGCTGCAAACAACATAAGCTTGG + Intronic
1057286592 9:93760599-93760621 GTCTGAAGCAAGAGTAAGCTTGG - Intergenic
1059721574 9:116965120-116965142 GACTACAAACAGACTAAGCTGGG - Intronic
1062586770 9:137253094-137253116 GGCTGCCGAAAGAGAAGGCTGGG - Exonic
1186247569 X:7631210-7631232 GGCTCAAAAAGGAGGAAGCTGGG + Intergenic
1186576794 X:10775294-10775316 GGCTGCAAGAAGAGTTAATTGGG + Intronic
1186663082 X:11688948-11688970 GGCTGCATAAAGAGGAAGAGAGG + Intergenic
1188005664 X:25014196-25014218 GCCTGCAAAAAGAGAAAGAAAGG - Intronic
1189668179 X:43380121-43380143 TGCTCAAAAAAGAATAAGCTAGG + Intergenic
1189824868 X:44907866-44907888 GGCTGCAAGAAGCATAAGCCTGG + Intronic
1189940768 X:46118119-46118141 GGCTGAAGAAGGAGAAAGCTGGG - Intergenic
1191667791 X:63721158-63721180 GGCTGCAAAAAGAGATACTTGGG - Intronic
1193188903 X:78545806-78545828 GGTTGAAAAAGGAGGAAGCTGGG - Intergenic
1193326067 X:80179803-80179825 GACTGCAAAAAGGGTAACCAGGG + Intergenic
1193341684 X:80355730-80355752 GGCTGAAAAGGGAGGAAGCTGGG - Intronic
1193787994 X:85784010-85784032 GGCTGGAGAGAGAGGAAGCTGGG + Intergenic
1195541604 X:106068697-106068719 GGCTGAAGGAAGAGGAAGCTGGG - Intergenic
1196527335 X:116741442-116741464 GCCTGCAAAATGAGTAAGGGAGG + Intergenic
1198321201 X:135520814-135520836 GGCTGCAGAAAGAGGAGGCCAGG + Exonic
1199016186 X:142819284-142819306 GGCTGAAAAGGGAGGAAGCTGGG + Intergenic
1199264084 X:145810058-145810080 GCCTGCAAAAAGTGCATGCTTGG - Intergenic
1199677674 X:150201433-150201455 GGCTGGAAAAACAGTATGTTTGG - Intergenic
1199921011 X:152404103-152404125 GGCTACACAAAGAGTAAGGATGG + Intronic