ID: 1052437017

View in Genome Browser
Species Human (GRCh38)
Location 9:28443354-28443376
Sequence GGCTGCACACTCTGTTGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052437012_1052437017 5 Left 1052437012 9:28443326-28443348 CCAGCTGCAGGTGGGGAGGCATG 0: 1
1: 2
2: 17
3: 73
4: 471
Right 1052437017 9:28443354-28443376 GGCTGCACACTCTGTTGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052437017 Original CRISPR GGCTGCACACTCTGTTGAGC TGG Intronic
No off target data available for this crispr