ID: 1052437915

View in Genome Browser
Species Human (GRCh38)
Location 9:28453761-28453783
Sequence CTCCTTGGCAACCACCTTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052437908_1052437915 25 Left 1052437908 9:28453713-28453735 CCCTTTATTTCATTGATGCTCCT 0: 1
1: 0
2: 1
3: 40
4: 367
Right 1052437915 9:28453761-28453783 CTCCTTGGCAACCACCTTCAGGG No data
1052437910_1052437915 5 Left 1052437910 9:28453733-28453755 CCTTTTGCTCAAGATCTTTTTGG 0: 1
1: 2
2: 9
3: 58
4: 544
Right 1052437915 9:28453761-28453783 CTCCTTGGCAACCACCTTCAGGG No data
1052437909_1052437915 24 Left 1052437909 9:28453714-28453736 CCTTTATTTCATTGATGCTCCTT 0: 1
1: 0
2: 0
3: 28
4: 320
Right 1052437915 9:28453761-28453783 CTCCTTGGCAACCACCTTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052437915 Original CRISPR CTCCTTGGCAACCACCTTCA GGG Intronic
No off target data available for this crispr