ID: 1052442999

View in Genome Browser
Species Human (GRCh38)
Location 9:28521933-28521955
Sequence TTGCTTCTTCTAGCTTGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1583
Summary {0: 2, 1: 7, 2: 82, 3: 402, 4: 1090}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052442999_1052443007 14 Left 1052442999 9:28521933-28521955 CCACCACAAGCTAGAAGAAGCAA 0: 2
1: 7
2: 82
3: 402
4: 1090
Right 1052443007 9:28521970-28521992 CTGTATCCATCGAGGGAGCATGG No data
1052442999_1052443005 7 Left 1052442999 9:28521933-28521955 CCACCACAAGCTAGAAGAAGCAA 0: 2
1: 7
2: 82
3: 402
4: 1090
Right 1052443005 9:28521963-28521985 TCCTTCTCTGTATCCATCGAGGG No data
1052442999_1052443004 6 Left 1052442999 9:28521933-28521955 CCACCACAAGCTAGAAGAAGCAA 0: 2
1: 7
2: 82
3: 402
4: 1090
Right 1052443004 9:28521962-28521984 ATCCTTCTCTGTATCCATCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052442999 Original CRISPR TTGCTTCTTCTAGCTTGTGG TGG (reversed) Intronic
900719873 1:4168695-4168717 TTGCTTCTTCCAGATTCTGGTGG + Intergenic
900744111 1:4349463-4349485 TTGCTGCTTCCAGCTTCTGGTGG + Intergenic
900790868 1:4679627-4679649 TTGCCTCTTCCAGCTTCTGGTGG + Intronic
900889571 1:5439968-5439990 TTGCCCCTTCTAGTTTCTGGTGG - Intergenic
901473542 1:9473802-9473824 TGGCCTCTTCCAGCTTCTGGGGG + Intergenic
901478280 1:9505800-9505822 CTGCTTCTTCCAGCTTTGGGAGG + Intergenic
902085067 1:13853608-13853630 TTGCCTTTTCTAGCTTTTAGAGG + Intergenic
902096060 1:13946992-13947014 TTGCCTCTTCCAGCTTCTGGTGG + Intergenic
902252856 1:15166833-15166855 TTGCTACATCTTGATTGTGGTGG - Intronic
902256349 1:15191218-15191240 TTGCCTCTTCCAGCTTCTAGAGG - Intronic
902568587 1:17332060-17332082 TTGCCTCCTCCAGCTTCTGGGGG + Intronic
902647070 1:17806985-17807007 TTGCCGTTTCCAGCTTGTGGAGG + Intronic
902704391 1:18194484-18194506 CTGCCTCTTCCAGCTTCTGGTGG + Intronic
902753249 1:18532150-18532172 TTGCATCTTCTGGCTTCAGGTGG - Intergenic
902754756 1:18541552-18541574 TGGCCTCTTCCAGCTTCTGGTGG + Intergenic
902766764 1:18621790-18621812 TTGCTTCTTCCAGCTTCTAGTGG + Intergenic
903388797 1:22948816-22948838 TTGCTTCTTCCAGTTTCTGGTGG + Intergenic
903469385 1:23575195-23575217 TTGCCTTTTCCAGCTTCTGGAGG - Intergenic
903527527 1:24003356-24003378 TTGCATCTTCTAGCCTTTGTTGG + Intergenic
903560428 1:24223111-24223133 TTGCTTCTTCTAGTCTAAGGTGG - Intergenic
903683618 1:25114655-25114677 TTGCTTCTTCCAGCTTCCAGAGG + Intergenic
904104770 1:28069961-28069983 TTGCCTCTCCCAGCTTCTGGTGG - Intronic
904203778 1:28839218-28839240 TTGCTTCTTCCCGTTTCTGGTGG + Intronic
904584247 1:31570728-31570750 TTGCCTCCTCCAGCTTCTGGTGG + Intergenic
905005311 1:34704944-34704966 TTTCTTCTTATAGCTTATGCTGG + Intergenic
905097227 1:35483884-35483906 TTGCCTCTTCTAGCTCCTGGAGG + Intronic
905267449 1:36764667-36764689 TTGCTTTTTCCAGCTTCTGGTGG + Intergenic
905683215 1:39889514-39889536 TTTCCTCCTCTAGCTTCTGGTGG + Intergenic
906817281 1:48892127-48892149 TTGCCTCTTCCAGCTTCTGGTGG + Intronic
907473392 1:54689291-54689313 TTGCCTATTCTGGCTTCTGGTGG - Intronic
907709926 1:56870349-56870371 TTGCCTCTTCCAGCTTTTGGTGG + Intronic
907769381 1:57444733-57444755 TTGCCTCTTCTGGCTTCTGGTGG - Intronic
907821387 1:57973260-57973282 TTGCCTCTTTGAGCTTCTGGTGG - Intronic
907866016 1:58399973-58399995 TTGCTTTTGCTAGCTTGAGCTGG - Intronic
907990218 1:59574224-59574246 TTGCTTCTTCCAGCATCTGGTGG + Intronic
908061381 1:60353590-60353612 TTGCTTCTCCTAGCTTTATGCGG + Intergenic
908321901 1:62986721-62986743 TTGCCTCTTCCACCTTCTGGTGG - Intergenic
908898012 1:68923234-68923256 TTTCTTTTTCCAGCTTCTGGAGG - Intergenic
909063224 1:70903177-70903199 TTGCCTCTTCCAGCTTCTGTTGG - Intronic
909148656 1:71971157-71971179 TTGGTTCTTCCAGGTTCTGGTGG - Intronic
909195371 1:72614893-72614915 TTGATTCTTCTAGGTTCTGGCGG - Intergenic
909388525 1:75089677-75089699 TTGCCTCCTCCAGCTTCTGGTGG + Intergenic
909563928 1:77034210-77034232 TTGCATCTTCCAGCTTCTGGTGG + Intronic
909634991 1:77807700-77807722 TGGCCTCTTCCAGCTTTTGGTGG + Intronic
909786208 1:79617269-79617291 TTGCCTCTTCCAGCTTTTGGTGG + Intergenic
910286606 1:85562697-85562719 TTATTTCTTCTAGCTTCTGGTGG - Intronic
910462059 1:87458240-87458262 TAGCCTCTTCTAGCTTCTGGTGG - Intergenic
910498156 1:87856618-87856640 TTGCTTCTTTCAGCTTTTCGTGG + Intergenic
911058473 1:93728030-93728052 TTGCCTCTCCCAGCTTCTGGTGG - Intronic
911266486 1:95750843-95750865 TTGCCTCTCCCAGCTTCTGGTGG - Intergenic
911326160 1:96471907-96471929 TTGCCTTTGCTAGCTTCTGGAGG + Intergenic
911742738 1:101404791-101404813 TTGCTTTTTCCAGCTTCTAGAGG + Intergenic
911863310 1:102983553-102983575 TTGCCTCTCCCAGCTTCTGGTGG - Intronic
912096264 1:106148760-106148782 TTGCCTCTTCCAGCTTCTGGTGG + Intergenic
912138893 1:106697034-106697056 TTGCCTTTTCCAGCTTCTGGTGG - Intergenic
912365470 1:109129987-109130009 TTGCCTCTTCCAGCCTCTGGTGG + Intronic
912458524 1:109816003-109816025 TGGCCTCTTCCAGCTTCTGGTGG - Intergenic
913674535 1:121128733-121128755 TTGCTTCTTTCAGCTTCTGGTGG - Intergenic
914026318 1:143916042-143916064 TTGCTTCTTTCAGCTTCTGGTGG - Intergenic
914254929 1:145954163-145954185 TTGCCTCTTCCAGCTTCTGGTGG - Intronic
914664755 1:149823795-149823817 TTGCTTCTTTCAGCTTCTGGTGG - Intergenic
914671010 1:149870023-149870045 TTGCTTCTTTCAGCTTCTGGTGG + Intronic
915550576 1:156630988-156631010 TTGCCTCTTCCAGCTTCTGGCGG + Intergenic
915782199 1:158564599-158564621 TTGCCTCTTTTAGCTTCTGATGG - Intergenic
916001022 1:160615880-160615902 TTGCCTCTTCCAGCATCTGGTGG - Intronic
916181704 1:162089769-162089791 TTGCCTCTTCCAGCTGCTGGAGG - Intronic
916182898 1:162102961-162102983 TGTCTTCTGCTAGCTTTTGGGGG + Intronic
916293793 1:163194539-163194561 TGGCTTCTACTACCTAGTGGAGG - Intronic
916475118 1:165161942-165161964 TTGCCTCGTCCAGCTTCTGGTGG - Intergenic
916489654 1:165290349-165290371 TTGCTGCTTCTGGCTTCTGGTGG + Intronic
916561654 1:165938950-165938972 TTGCCTTTCCTAGCTTCTGGAGG + Intergenic
916801871 1:168223459-168223481 TTGCCTCTTCCAGCTTCTAGTGG + Intergenic
916846327 1:168654346-168654368 TTGCTTCTTCCAACTTCTGGTGG + Intergenic
917017343 1:170548171-170548193 TTGCCTCTTCCAGCTTCTGGTGG + Intronic
917066571 1:171101145-171101167 TTGCCGCTTCTGGCTTCTGGTGG - Intronic
917233286 1:172861569-172861591 TTGCTTTTTCCAGCTTCTAGAGG - Intergenic
917551404 1:176034484-176034506 TTGCTTCTTTGCCCTTGTGGTGG + Intronic
917674893 1:177309681-177309703 TTGCCCCTTCCAGCTTCTGGTGG - Intergenic
918000093 1:180485563-180485585 TTGCCTCTTCCAGCTTATGGTGG - Intronic
918003800 1:180523293-180523315 TTGCCTCTTCTGGCTACTGGTGG - Intergenic
918021214 1:180693663-180693685 TTGCCTCTTACAGCTTCTGGTGG + Intronic
918254532 1:182737079-182737101 TTGCCTCTTCCAGCTTCAGGTGG + Intergenic
918651743 1:186973247-186973269 TTGCCTTTTCCAGCTTTTGGTGG + Intronic
918687068 1:187430159-187430181 TTGCTTCTACCAGCTTTTAGAGG - Intergenic
918885930 1:190194243-190194265 TTGCTTCTTCCAGCTTTTGGTGG - Intronic
918966739 1:191360398-191360420 TTGTCTCTTCTAGCTTCTGATGG + Intergenic
919122385 1:193357224-193357246 TTGCTTCTTCCAGCTTCTGGTGG - Intergenic
919192730 1:194244775-194244797 TTGCCTCCTCCAGCTTCTGGTGG - Intergenic
919232980 1:194799742-194799764 TTGCTTCTTCCAGCTCCCGGTGG - Intergenic
919294584 1:195679791-195679813 TTGCCTTTTCTAGCTTCTGGAGG - Intergenic
919506143 1:198399663-198399685 TTGCTTCTTTCAGCTTCTGGTGG - Intergenic
919508303 1:198428157-198428179 TTGCTTATTTCAGCTTCTGGTGG - Intergenic
919817728 1:201452049-201452071 TTGCCTCTTTTAGCTTTGGGTGG - Intergenic
919819881 1:201466151-201466173 TTGTTCCCTCTGGCTTGTGGGGG - Exonic
920411018 1:205760891-205760913 TTGCTTTTTCTGGCTTCTAGAGG - Intergenic
920706743 1:208256778-208256800 TTGCCTCTTCCAGCTTCTGGTGG + Intergenic
920760284 1:208777217-208777239 TTGCCTCTTCTAGTTTCTGGTGG - Intergenic
920763604 1:208809858-208809880 TTGCCTCGTCCAGCTTCTGGTGG - Intergenic
920862374 1:209721079-209721101 TTGCCTCTTCCAGCTTCTAGTGG - Intronic
920961995 1:210671665-210671687 TTACCTCTTCCAGCTTCTGGTGG - Intronic
920972261 1:210753020-210753042 TTGCCTCTTTCAGCTTCTGGTGG - Intronic
921151593 1:212407302-212407324 TTGCCTTTTCTAGCTTCTGGAGG - Intronic
921237056 1:213143873-213143895 TTGTCTTTTCTAGCTTCTGGTGG + Intronic
921252924 1:213314074-213314096 TCGCCTCTTCCAGCTTCTGGGGG + Intergenic
921275773 1:213518454-213518476 TTGCTTCTTCCAGCTTCTGGTGG - Intergenic
921716440 1:218421911-218421933 TTGCCTCTTCTAGCATCTGGTGG - Intronic
921780362 1:219155699-219155721 TTGCTTCTTCCAGCTTCTGGTGG - Intergenic
921811215 1:219516472-219516494 TTGCATTTTCTAGCTTCTAGAGG - Intergenic
922315914 1:224441936-224441958 TAGCTTCTTGTGGCTAGTGGAGG + Intronic
922392202 1:225156410-225156432 TTGCCTCCTCCAGCTTCTGGTGG + Intronic
922601789 1:226861545-226861567 TTACCTTTTCTAGCTTCTGGAGG + Intergenic
923714228 1:236411367-236411389 TTGTCTCTTCTAGCTTGTAGTGG + Intronic
923774795 1:236968618-236968640 TTGCATCTTCTAGCTTCTGATGG + Intergenic
923891415 1:238219263-238219285 CTGCTTCTTCCAGCTTCAGGTGG - Intergenic
923910343 1:238434469-238434491 TTGCATATTCCAGCTTCTGGTGG + Intergenic
924002031 1:239564992-239565014 TTGCCTCTTCCCGCTTCTGGTGG + Intronic
924402407 1:243699939-243699961 TTGTCTCTTCTTGCTTCTGGTGG - Intronic
924937011 1:248780469-248780491 TTGCCTCTTCCAGCCTCTGGTGG - Intergenic
924948289 1:248860510-248860532 TTGCTTCTTCTAGCTTCTAATGG + Intergenic
1063553158 10:7052277-7052299 TTGCCTCTTCCAGCTCCTGGTGG - Intergenic
1063758803 10:9047874-9047896 TTGCTTTTTCTAGTTTTTAGAGG + Intergenic
1063845933 10:10126796-10126818 TTGCCTTTTCCAGCTTCTGGAGG + Intergenic
1063868774 10:10396070-10396092 TTGCCTCTTCCAGCTAATGGTGG - Intergenic
1064316061 10:14257765-14257787 TTTTCTCTTCTAGCTTCTGGTGG - Intronic
1064504343 10:16013098-16013120 TTGCCTTTTCCAGCTTGTAGAGG + Intergenic
1064540175 10:16397215-16397237 TTGCTTTTTCCACCTTCTGGAGG + Intergenic
1064596150 10:16947358-16947380 TATTTTCTTCCAGCTTGTGGTGG - Exonic
1064983718 10:21189341-21189363 TTGCTTTTTCCAGCTTCTGGTGG - Intergenic
1065001699 10:21343182-21343204 TTGCCTCTTCCAGCTTCTAGTGG + Intergenic
1066456552 10:35577261-35577283 TTGCCTCTTCCAGCTTCTGCTGG - Intergenic
1067041796 10:42958018-42958040 TTGCCTCTTCTGCCTTCTGGTGG - Intergenic
1067328190 10:45289782-45289804 TTGCCTCTTCTGGCTAGTGGTGG + Intergenic
1067424782 10:46198644-46198666 TTGCCTCTTCTAGCTTCTGGTGG + Intergenic
1067788779 10:49272210-49272232 TGGCCTCTTCCAGCTTCTGGTGG - Intergenic
1067789067 10:49273858-49273880 CTGCCTCTTCCAGCTTCTGGTGG - Intergenic
1067789115 10:49274285-49274307 TGGCCTCTTCCAGCTTCTGGTGG - Intergenic
1068161713 10:53272796-53272818 TTGATTCTTCATGCTTGTAGGGG - Intergenic
1068345296 10:55770067-55770089 TTGCCTCTTCTAGTTTCAGGTGG - Intergenic
1068780761 10:60916983-60917005 TTACCTCTTCTAGCTTCTGTGGG - Intronic
1068900220 10:62259914-62259936 TTGGATCTTCTAGATTGTGAAGG - Intronic
1068941783 10:62687935-62687957 TTGCTTCTCCTGGGTGGTGGTGG - Intergenic
1069004158 10:63298390-63298412 TTGCCTCTCCTAGCTTCTGGTGG + Intronic
1069404212 10:68080961-68080983 TTGCCTTTTCTAGCTTTTGGTGG + Intergenic
1070499712 10:77060884-77060906 TTGCATTTTCTAGCTTCTGGAGG - Intronic
1070645426 10:78198864-78198886 TTTCCTCTTCCAGCTTCTGGGGG - Intergenic
1070861264 10:79664872-79664894 TTGCCTCTTCTAGCTTCTGGTGG + Intergenic
1070875989 10:79810722-79810744 TTGCCTCTTCTAGATTCTGTTGG - Intergenic
1071090154 10:81909101-81909123 TTGCTTCTTTTAGATTCTAGTGG + Intronic
1071216311 10:83406572-83406594 TTGCCTCTTCTAGCTTCTAGAGG + Intergenic
1071247202 10:83777913-83777935 TTGCTTTTTCTAGTTTCTTGAGG - Intergenic
1071459193 10:85876292-85876314 TCACTTCTTCCAGCTTCTGGTGG + Intronic
1071642921 10:87332857-87332879 TTGCCTCTTCTAGATTCTGTTGG - Intergenic
1071853538 10:89600030-89600052 TTGCCTCTTCCAGCTTCTGGTGG - Intronic
1071876567 10:89849436-89849458 TTGCTTCTTCCAGCTTCTGATGG - Intergenic
1071890450 10:90000685-90000707 TTTTTTCTTCTAGCTGTTGGAGG + Intergenic
1072040153 10:91599445-91599467 TTGCCTCTTCCAGTTTCTGGTGG + Intergenic
1072051897 10:91713039-91713061 TTGCCTCTTCCGGCTTCTGGGGG - Intergenic
1072581642 10:96745082-96745104 TTGCTCCTTCCAGCTTCTGGTGG + Intergenic
1072786289 10:98285313-98285335 TAGCTTCTTCCAGCTTCTGGTGG - Intergenic
1072977451 10:100071367-100071389 TTGTTTCTTCCAGGTTCTGGTGG + Intronic
1073620079 10:105037481-105037503 TGCCTTTTTCTAGCTTCTGGTGG + Intronic
1074100593 10:110351851-110351873 TTGCCTCTTCTGGCTTCTTGTGG - Intergenic
1074220802 10:111435961-111435983 TTGCCTTTTCTAGCTTCTAGAGG + Intergenic
1074247013 10:111704473-111704495 TTGCTTTTTCCAGCTTCTGGGGG + Intergenic
1074358619 10:112807401-112807423 TTGCCTCTTGCAGCTTCTGGTGG + Intronic
1074607501 10:114988401-114988423 TTGCTTGTTATAGCTTGTCATGG + Intergenic
1074610306 10:115015241-115015263 TTCCTCTTTCTAGCTTCTGGTGG + Intergenic
1074667809 10:115751228-115751250 TTGCCTTTTCCAGCTTGTAGAGG - Intronic
1074689289 10:115989875-115989897 TCGCTTATTCTAGCTTCTGGTGG + Intergenic
1074713422 10:116196951-116196973 TTGCTTCTTCCTGCTTCTGCTGG + Intronic
1074760963 10:116667233-116667255 TTGCTTCTTCCAGCTTCTGGTGG - Intronic
1074847170 10:117408566-117408588 TTGCTTCCTCCAGCTTCTGGTGG - Intergenic
1075117827 10:119641841-119641863 CTGCCTCTTCCAGCTTCTGGAGG + Intergenic
1075125837 10:119698188-119698210 CTGCCTCTTCCAGCTTCTGGTGG + Intergenic
1075191629 10:120314967-120314989 TTTCCTCTTCCAGCTCGTGGGGG + Intergenic
1075298529 10:121299616-121299638 TTGCCTCTTTTGGCCTGTGGAGG - Intergenic
1075318058 10:121467923-121467945 TTACCTCTTCTGGCTTCTGGTGG - Intergenic
1075536549 10:123276500-123276522 TTGCTTCTTCCAGATTCTGGTGG - Intergenic
1075548028 10:123370221-123370243 TTGCCTCTTCCAGCTTCTGGTGG - Intergenic
1075813974 10:125250178-125250200 TTGCCTCTTCCAGCCTCTGGTGG + Intergenic
1075884417 10:125885553-125885575 TTGCCTCTTCTAGCTCCTAGAGG - Intronic
1076207998 10:128618569-128618591 ATCCTTCTTCTAGCTTCTGGTGG + Intergenic
1076241732 10:128913764-128913786 TAGTCCCTTCTAGCTTGTGGGGG + Intergenic
1076899793 10:133332872-133332894 TTGCTTCCTCCAGCTTCTGGTGG - Intronic
1077274354 11:1696725-1696747 CTGCGTCTTCCAGCTTCTGGTGG - Intergenic
1077336511 11:2007282-2007304 TTGCCCCTTCTGGCTTCTGGGGG + Intergenic
1077552907 11:3209688-3209710 TTGCTTTTTCCAGCTTCTAGAGG + Intergenic
1077582710 11:3427154-3427176 TTGCCTCTTCTGGCTTCTGGTGG - Intergenic
1077586952 11:3461081-3461103 TTGCCTCTTCTGGCTTCTGGTGG + Intergenic
1077590221 11:3485290-3485312 TTGCGTCTTCCAGCTTATAGAGG - Intergenic
1077788444 11:5411885-5411907 TTGCCTTTTCCAGCTTGTAGAGG - Intronic
1078378499 11:10817570-10817592 TTGCCTCTTCTAGCTTCTGGTGG + Intronic
1078418426 11:11185195-11185217 TTGCCTCTTCCAGTTTCTGGTGG - Intergenic
1078587576 11:12606804-12606826 TTGCTCCTTCCAGCTTCTGGAGG + Intergenic
1079022088 11:16917510-16917532 TTGCCTCTTCCAGCTTCTAGAGG + Intronic
1079370984 11:19852023-19852045 TTACCTTTTCCAGCTTGTGGAGG - Intronic
1079510668 11:21206211-21206233 TTGCCTCTTCCACCTTCTGGTGG + Intronic
1079917305 11:26385489-26385511 TTGCATTTTCTAGCTTCTAGAGG + Intronic
1079967692 11:26998713-26998735 TGGCTTCTTATAGCTTCTGATGG - Intergenic
1080228405 11:29987056-29987078 TTGCCTTTTCTAGCTTCTAGGGG - Intergenic
1080299366 11:30767529-30767551 TTGCCTTTTCCAGCTTCTGGAGG + Intergenic
1080928635 11:36784637-36784659 TTGCTTCTTCTGGATGTTGGAGG - Intergenic
1080931462 11:36815850-36815872 TTGCTTTTTCCAGCTTCTGGTGG - Intergenic
1081464195 11:43301176-43301198 TTTCCTCTTCCAGCTTCTGGTGG - Intergenic
1081926153 11:46830513-46830535 TTGCCTCTTCCAGCTTCTGGTGG - Intronic
1082711521 11:56559120-56559142 TTGCTTTTTCCAGGTTTTGGAGG + Intergenic
1082762185 11:57138067-57138089 TTGCTTCTTCTAGCTTCTGATGG + Intergenic
1083058750 11:59847877-59847899 TTGCCTTTTCCAGCTTCTGGAGG - Intergenic
1083063584 11:59899772-59899794 CTGCTTCTTCTATCTTGCTGAGG + Intergenic
1083362059 11:62116638-62116660 TTGCCTCTTTCAGCTTCTGGTGG + Intergenic
1083489533 11:63005736-63005758 TTGCCTCTGCCAGCTTCTGGTGG - Intronic
1084239608 11:67809974-67809996 TTGCCTATTCTGGCTTCTGGTGG - Intergenic
1084245943 11:67857064-67857086 TTGCATCTTCCAGCTTATAGAGG - Intergenic
1084294686 11:68204487-68204509 TTGCTTCTTCCAGCCTCTGGTGG - Intronic
1084369431 11:68730054-68730076 TGTCATCTTCTAGCTGGTGGAGG - Intronic
1084377835 11:68790555-68790577 ATGCCTCTTCCAGCTTCTGGGGG - Intronic
1084402702 11:68954442-68954464 TTGCCTTTTCTAGCTTCTAGAGG - Intergenic
1084443338 11:69188706-69188728 TTGCCTTTTCCAGCTTCTGGAGG - Intergenic
1084659254 11:70537512-70537534 CTGCCACTTCTAGCTTCTGGGGG - Intronic
1084672242 11:70614173-70614195 TGGCCTCTTCCAGCTTCTGGTGG - Intronic
1084684098 11:70683669-70683691 TTGCTTCTTGCCGCTTCTGGTGG + Intronic
1084826731 11:71737442-71737464 TTGCGTCTTCCAGCTTATAGAGG + Intergenic
1084830042 11:71761862-71761884 TTGCCTCTTCTGGCTTCTGGTGG - Intergenic
1084832815 11:71782876-71782898 TTGCCTCTTCTCGCTTCTGGTGG + Intergenic
1085196400 11:74674679-74674701 TTGCCTTTTCTAGCTTCTAGAGG + Intergenic
1086283581 11:85219549-85219571 TTGCATTTCCTAGCTTCTGGTGG + Intronic
1087815664 11:102655665-102655687 TTGCCTCTTCTACGTTTTGGTGG + Intergenic
1087952735 11:104243837-104243859 TTACCTTTTCTAGCTTCTGGTGG + Intergenic
1087962185 11:104366017-104366039 TTGCTGCTGCTAGCTTGGGTGGG + Intergenic
1088156832 11:106815893-106815915 TTGCTTCTTCTAGCTTTTTGTGG - Intronic
1088332348 11:108666631-108666653 CTGCCTCTTGTAGCTTCTGGTGG + Intronic
1088386341 11:109261229-109261251 TTGCTTCTTCTAGTTTCTTGAGG + Intergenic
1088574846 11:111260635-111260657 TTGCTTTTTCAAGCTTCTGGTGG - Intronic
1088710749 11:112506343-112506365 TTGCCTCTTCTGGCTTCTGCTGG + Intergenic
1089135105 11:116242669-116242691 TTGCCTCTTCCAGCTTTTGGTGG - Intergenic
1089276299 11:117338268-117338290 TTGTTTCTTCTATCTGGGGGAGG + Intronic
1089307836 11:117537807-117537829 TGGCCTCTCCTAGCTTCTGGTGG - Intronic
1089686700 11:120154172-120154194 TTGCCTTTTCCAGCTTGTAGAGG + Intronic
1089864285 11:121618164-121618186 TAGCCTCTTCTAGCTTAGGGAGG + Intronic
1090091727 11:123703949-123703971 TTGCCTCTTCCAGCTTCTGGTGG - Intergenic
1090104621 11:123839334-123839356 TTGCCTTTTCTAGCTTTCGGAGG + Intergenic
1091224076 11:133947155-133947177 CGGCGTCCTCTAGCTTGTGGTGG - Intronic
1091256134 11:134187651-134187673 TTTCTTCTTCTGGCTTAGGGTGG - Intronic
1202819495 11_KI270721v1_random:62464-62486 TTGCCCCTTCTGGCTTCTGGGGG + Intergenic
1091648513 12:2291860-2291882 TCTCTTCTTCTAGCTGATGGAGG - Intronic
1091783517 12:3228884-3228906 TTGCCTCTCCCAGCTTCTGGAGG + Intronic
1091893131 12:4078269-4078291 TTTCTGCTTCTAGGTTGTTGAGG - Intergenic
1092042162 12:5394512-5394534 CTGCTTTTTCCAGCTTCTGGTGG - Intergenic
1092413190 12:8269826-8269848 TTGCCTCTTCTGGCTTCTGATGG + Intergenic
1092416522 12:8294193-8294215 TTGCATCTTCCAGCTTATAGAGG - Intergenic
1092486905 12:8909865-8909887 TTGCTTTTTCTGGCTTCTGAAGG + Intergenic
1092863975 12:12743887-12743909 TTGCCTCTTCCAGCTTCTGGAGG - Intronic
1092941055 12:13407570-13407592 TTGCCTTTTCTAGTTTCTGGTGG + Intergenic
1092987020 12:13855561-13855583 TTGCCTCTTCCAGTTTCTGGCGG + Intronic
1093841075 12:23901253-23901275 TTGCATTTTCTAGCTTGTAGAGG - Intronic
1093994653 12:25628739-25628761 TTGCCTCTTTTAGCTTCTAGAGG - Intronic
1094060154 12:26306009-26306031 GTTCTTCTTCTAGTTTGTTGAGG - Intergenic
1094101658 12:26770926-26770948 TTGCCTCTTCCAGCTTCTGGTGG + Intronic
1094390201 12:29940625-29940647 TTGCCTCTTCCAGCTCCTGGTGG - Intergenic
1094544957 12:31396018-31396040 TTGCCTCTTTTAGCTTCTGGTGG + Intronic
1095248884 12:39955828-39955850 TTCCTTTTTCCAGCTTCTGGGGG - Intronic
1095332988 12:40991160-40991182 TTGCTTCTTTCAGCTTCTGATGG + Intronic
1095645662 12:44542910-44542932 TTGCATCTTCCAGCTTCTGGTGG - Intronic
1095721315 12:45404545-45404567 TTGCCTTTCCTAGCTTCTGGAGG + Intronic
1095916998 12:47489759-47489781 TTGATTCTTCCAGCTTTTGGAGG + Intergenic
1096164147 12:49406676-49406698 TTGCTACTTCTATCTTTTGGTGG + Intronic
1096183325 12:49563226-49563248 TTGCTTCTTCCAGCTCCTGGGGG - Intronic
1096482198 12:51949932-51949954 TTGCCTCTTCTAGCTTCTGGTGG - Intergenic
1097388379 12:58978730-58978752 TTGCCTCTTCCAGCTTCTGGTGG + Intergenic
1097447623 12:59692091-59692113 ATGCCTCTTCTAGCTTCTGGTGG + Intronic
1097542991 12:60963362-60963384 TGGCTTCTTCCAGCTACTGGTGG - Intergenic
1097548449 12:61035330-61035352 TCGCTTCTTCTGGCTTCTGGCGG + Intergenic
1097552149 12:61087576-61087598 TTACATGTTCTAGCTTATGGTGG - Intergenic
1097583948 12:61492774-61492796 TTGCCTTTTCTAGTTTCTGGAGG - Intergenic
1097900582 12:64869308-64869330 CTGCTACTTCTAACTTTTGGTGG + Intronic
1097974567 12:65670804-65670826 TTGCCTCTCCCAGCTTCTGGTGG + Intergenic
1098295905 12:69003971-69003993 ATGCCTCTCCTAGCTTCTGGTGG - Intergenic
1098338894 12:69431617-69431639 TTGCTTCTTCAAACTTCTGGTGG - Intergenic
1098654627 12:73012798-73012820 TTGATTCTTCATGCTTGTAGGGG + Intergenic
1098803712 12:74994588-74994610 TTGCCTTTTTTAGCTTCTGGAGG - Intergenic
1098835304 12:75417321-75417343 TTGATTTTTCCAGCTTCTGGTGG - Intronic
1098873859 12:75846484-75846506 TTGCCTCCTCCAGCTTCTGGTGG + Intergenic
1099064261 12:77954030-77954052 TTTCCTTTTCTAGCTTATGGTGG + Intronic
1099449536 12:82792053-82792075 TTGCTGCTTCTTGCTTCTGTGGG - Intronic
1099734899 12:86554915-86554937 TTGCTTTTTCCTGCTTCTGGAGG + Intronic
1099925463 12:89011236-89011258 TTGCTTCTTCCAGCTTCTGATGG + Intergenic
1100017863 12:90033940-90033962 TTGCCTCTTCTAGTTTCTGGTGG - Intergenic
1100019501 12:90052013-90052035 TTGCCTTTTCTAGCTTCTAGAGG - Intergenic
1100059460 12:90556010-90556032 TTCCTGCCTCTATCTTGTGGAGG + Intergenic
1100190109 12:92181214-92181236 TTGATTATTCTAGTTTCTGGTGG - Intergenic
1100226010 12:92556312-92556334 TTGTTTCTTATGCCTTGTGGAGG + Intergenic
1100786119 12:98080358-98080380 TTGCCTCTTCCAGCTTCTGGTGG - Intergenic
1100882308 12:99032409-99032431 TTGCTTCTTTGAGCTTCTGGTGG + Intronic
1100890390 12:99119284-99119306 TTACCTCTTCTAGCATCTGGCGG - Intronic
1101004227 12:100385908-100385930 TTGACTCTTCTAGCTTCTAGTGG + Intronic
1101022628 12:100568811-100568833 TTGCATCTTCTGGCTTCTGATGG + Intergenic
1101089003 12:101265610-101265632 TTGGTTTTTCCAGCTTCTGGAGG - Intergenic
1101191297 12:102336271-102336293 TTGCTTTTTGCAGCTTCTGGGGG - Intergenic
1101407934 12:104445363-104445385 TTGCCTCTTCCAGCTTCTGGCGG - Intergenic
1101412444 12:104480752-104480774 TTGTTTCTTCCAGCTTCTGGTGG - Intronic
1101561640 12:105862811-105862833 TTGCCTCTTTTAGCTTCTAGAGG + Intergenic
1101637247 12:106554614-106554636 TTGCCTCTTCCAGCTTCTGGTGG + Intronic
1101731090 12:107427165-107427187 TTGCCTCTTCCAGCTTCTAGAGG + Intronic
1101836568 12:108299754-108299776 TTGCCTCTGCCAGCTTCTGGTGG - Intronic
1101998474 12:109541770-109541792 CTGCCTCTTCTAGCTTCTGGTGG + Intergenic
1102054944 12:109889502-109889524 TTGCCTCTTCCAGCCTCTGGTGG + Intergenic
1102231804 12:111267712-111267734 TGGCTTCTTCCAGCTTCTGGTGG + Intronic
1102366223 12:112338138-112338160 TTGCTTCTTCCAGCTTCTGTTGG + Intronic
1102592754 12:113969460-113969482 TTGCTTCTTTCAGCTTCTGGTGG - Intergenic
1102720842 12:115014575-115014597 TTGCTTCTTCCAGCTTCTGATGG + Intergenic
1102738894 12:115188431-115188453 TTGCCTCTTCTAGCTTCTGATGG - Intergenic
1102813289 12:115842394-115842416 TTGCCTTTTCCAGCTTCTGGAGG - Intergenic
1102920306 12:116786845-116786867 TTGCCTCTTCGGGCTTCTGGTGG + Intronic
1103005233 12:117415571-117415593 ATGCCTCTCCTAGCTTCTGGTGG + Intronic
1103029555 12:117601604-117601626 TTGCCTCTCCCAGCTTCTGGTGG - Intronic
1103067685 12:117913658-117913680 TTGCCCCTTCCAGCTTCTGGGGG - Intronic
1103157306 12:118696970-118696992 TCGCCTCTTCCAGCTTCTGGTGG - Intergenic
1103166357 12:118773675-118773697 TTGCCTCCTCCAGCTTCTGGTGG - Intergenic
1103192734 12:119016153-119016175 TTGCTTCTTCCAGCTTCTGGTGG - Intronic
1103469828 12:121171242-121171264 TTGCCTCTTCCAGCGTCTGGTGG + Intronic
1103676524 12:122660340-122660362 TTGCCTCTTCCAGCTCCTGGTGG + Intergenic
1103730753 12:123026330-123026352 TTGTCTCTTCCAGCTTCTGGTGG - Intronic
1103737110 12:123067603-123067625 TTGCCTCTTGCAGCTTCTGGTGG - Intronic
1103836420 12:123824664-123824686 TTGCCTCTTCCAGCTCCTGGTGG + Intronic
1103843988 12:123888554-123888576 TTGCCTCCTCTGGCTTCTGGTGG - Intronic
1103890358 12:124233991-124234013 TTGCTTCTTCTTGCTGGTGGTGG - Intronic
1103967257 12:124647683-124647705 TTGCCTTTTCTGGCTTCTGGGGG + Intergenic
1104024409 12:125015393-125015415 TCGCCTCTTCCAGCTTCTGGTGG - Intronic
1104056077 12:125231107-125231129 TTGCCTCTTCCAGCTCCTGGTGG + Intronic
1104060502 12:125264098-125264120 TTGCTTTTTCCAGCTTCTAGAGG + Intronic
1104099354 12:125591705-125591727 TTGCCTCTTCCAGCTTCTGGTGG + Intronic
1104289059 12:127451860-127451882 TTACTTCTTCCAGCTTCTGGAGG + Intergenic
1104421729 12:128641588-128641610 TTGCCTCTTCCAGCTGCTGGTGG - Intronic
1104447224 12:128844396-128844418 TTGCATCTTTTGGCTTCTGGTGG - Intergenic
1105099477 13:16428013-16428035 ATGCTCTTTCTAGCTTGTAGGGG - Intergenic
1105118472 13:16738211-16738233 TTGTTCTTTCTAGCTTGTAGGGG - Intergenic
1105122727 13:16807824-16807846 TTGTTCTTTCTAGCTTGTAGGGG - Intergenic
1105125644 13:16855398-16855420 ATGCTCCTTCTAGCTTGTAGGGG - Intergenic
1105138228 13:17061071-17061093 ATGCTCTTTCTAGCTTGTAGGGG - Intergenic
1105138800 13:17070611-17070633 ATGCTCTTTCTAGCTTGTAGGGG - Intergenic
1105140629 13:17100637-17100659 ATGCTCTTTCTAGCTTGTAGGGG - Intergenic
1105142986 13:17138661-17138683 ATGCTCTTTCTAGCTTGTAGGGG - Intergenic
1105235267 13:18545391-18545413 TTGCCTCTTCCAGCTTTTGGTGG + Intergenic
1105540849 13:21315197-21315219 ATGCCTCTGCTAGCTTCTGGTGG - Intergenic
1105560654 13:21487649-21487671 TTGCTTGTTTTTGCTTGTTGTGG + Intergenic
1105645247 13:22311329-22311351 TTGTCTCTTCCAGCTTCTGGTGG - Intergenic
1105674909 13:22660652-22660674 TTGCCTCTTCTAGCTTCTTGTGG - Intergenic
1106196394 13:27497834-27497856 TTGCTTATTCCAGCTTCTAGAGG + Intergenic
1106245718 13:27948233-27948255 TTGCTTCTTCCAGCTTCTAGTGG + Intergenic
1106767504 13:32928876-32928898 TTGCCTCTTCCAGCTGCTGGTGG - Intergenic
1106844842 13:33727398-33727420 TTGCTTCTTCTATTTTGAGGAGG + Intergenic
1107043094 13:35969440-35969462 TTGTCTCTTCCAGCTTCTGGTGG - Intronic
1107082603 13:36390933-36390955 TTGCTTCTTCCAGCTTTAGAGGG + Intergenic
1107117727 13:36765147-36765169 TTGCCTCCTCTAGCTTCTAGTGG + Intergenic
1107307964 13:39043402-39043424 TTGCCGCTTCTAGTTTCTGGTGG + Intronic
1107310423 13:39072005-39072027 TTGCCTCTTCCAGCTATTGGTGG - Intergenic
1107374176 13:39784374-39784396 CTGCCTCTTCTAGGTAGTGGTGG - Intronic
1107384977 13:39898284-39898306 TTACCTTTTCTAGCTTCTGGAGG - Intergenic
1107658114 13:42612566-42612588 TTGCTTCTTCCAGCTCATGGTGG + Intergenic
1107799892 13:44095816-44095838 TTGATTATTCCAGATTGTGGGGG + Intergenic
1107803830 13:44135397-44135419 TTGCCTCTCCTAGCTTCTGCTGG - Intergenic
1107808880 13:44180366-44180388 TTGCCGCTTCTGGCTTCTGGTGG + Intergenic
1107811604 13:44206100-44206122 TTGCATTTTCCAGCTTCTGGTGG - Intergenic
1107897078 13:44975878-44975900 TCGGTTCTTCTATCTTGTGGTGG - Intronic
1107980544 13:45730416-45730438 TTGCTTTTCCCAGCTTCTGGTGG + Intergenic
1107990821 13:45817703-45817725 TTGCCTCTTCCAGCTTTGGGTGG - Intronic
1108115113 13:47118980-47119002 TGGCCTCTCCTAGCTTCTGGTGG - Intergenic
1108167115 13:47705011-47705033 CTGCGTCTTCCAGCTTTTGGTGG + Intergenic
1108207295 13:48103212-48103234 TTGCTTCTCCCAGCTTCGGGAGG - Intergenic
1108721890 13:53140709-53140731 TTGCCTCTTCCAGCTTCTAGTGG + Intergenic
1108825279 13:54406266-54406288 TTGCTGCTTCTACCATGTGAGGG - Intergenic
1109569694 13:64171579-64171601 TTGCTTCTTCTAGCTTCTGGTGG - Intergenic
1109640006 13:65179302-65179324 TTACTTCTTCCAGATTCTGGTGG - Intergenic
1109663815 13:65502886-65502908 TTGCCTCATCCAGCTTCTGGTGG + Intergenic
1110202259 13:72866039-72866061 TTGCTTCTTCCAGCTTCTGGGGG + Intronic
1110481446 13:75982321-75982343 ATGCGTCTTGTAGCTTCTGGTGG - Intergenic
1110655765 13:77996959-77996981 TTGCCTTTTCTAGCTTCTAGGGG + Intergenic
1110725913 13:78823400-78823422 CTGCCTCTCCTAGCTTCTGGTGG + Intergenic
1110939878 13:81336557-81336579 TTCCCTCTTCTGGCTTCTGGCGG - Intergenic
1111083239 13:83340063-83340085 TTGCTTCTTCTAGCTTCTGATGG - Intergenic
1111173766 13:84565136-84565158 AGGCTTCTTCTAGCTTCTGCTGG + Intergenic
1111197465 13:84894065-84894087 TTGTTCCTTCTTGCTTCTGGTGG + Intergenic
1111436462 13:88216209-88216231 CTATTTCTTCTAGCTTCTGGTGG - Intergenic
1111664345 13:91248555-91248577 TTGTTTCTTGCAGCTTCTGGTGG + Intergenic
1111841628 13:93456760-93456782 TAGCATCTTGTAGCTTCTGGTGG + Intronic
1111931535 13:94517861-94517883 TTGCCTCTTCCAACTTCTGGTGG - Intergenic
1112007432 13:95266360-95266382 TTGCCTCTTCCAGCTTCTGGTGG - Intronic
1112212878 13:97398497-97398519 TTGACTCTTCTAGCTTCTGCTGG + Intergenic
1112366171 13:98757273-98757295 TTGTCTCTTCCAGCTTCTGGTGG + Intergenic
1112402803 13:99090085-99090107 TTGCCTCTTCCAGTTTCTGGTGG - Intergenic
1112443385 13:99441937-99441959 TTGCCTCTTCCAGCTTGCGGCGG - Intergenic
1112520999 13:100095069-100095091 TTGCCTCTTTGAGCTTCTGGTGG + Intronic
1112584566 13:100706909-100706931 TTGCCTCTTCCAGCTTGTGGTGG + Intergenic
1112595815 13:100805984-100806006 TTGCCTCTTCCAGCTCCTGGTGG + Intergenic
1112800497 13:103104502-103104524 TTGCATTTTCTAGCTTCTGGAGG + Intergenic
1112809425 13:103200427-103200449 TTGCTTTTTTCAGCTTTTGGAGG + Intergenic
1112956411 13:105064269-105064291 TTGCTTCTTCTTGCTTTTGGTGG - Intergenic
1113084200 13:106550749-106550771 CTGCCTCTTCCAGCTTCTGGTGG + Intronic
1113104543 13:106758516-106758538 TTCCCTCTTCCAGCTTCTGGTGG + Intergenic
1113123801 13:106954172-106954194 TTGCCTCTTCTGGCTTGTGGTGG + Intergenic
1113328229 13:109304143-109304165 TTGCTTCTTCTTTCCTCTGGTGG - Intergenic
1113637615 13:111930576-111930598 TTGCTTCGTCTACATTGTGGCGG + Intergenic
1113673385 13:112190558-112190580 TTGCCTTTTCCAGCTTTTGGTGG + Intergenic
1114214086 14:20642641-20642663 TTGATTTTTCTAACTGGTGGTGG - Intergenic
1114694558 14:24614279-24614301 ATGCTTCTCCTAGCTTCTAGGGG + Intergenic
1114778359 14:25512205-25512227 ATGCTTTTTCCAGCTTCTGGTGG - Intergenic
1115198716 14:30830107-30830129 TTGTTCCTTCCAGCTTCTGGTGG - Intergenic
1115494870 14:33993229-33993251 TTGTCTCTTCCAGCTTGTAGGGG - Intronic
1115569190 14:34651054-34651076 TTGCTTTTTCTGGCCTCTGGAGG + Intergenic
1115597531 14:34923632-34923654 TTGCCTCTTCTGGCTTCTAGAGG + Intergenic
1115756316 14:36528984-36529006 TTGCTTCTTCCAGCTTCTGGAGG + Intergenic
1115967249 14:38904760-38904782 TTGCCTTTTCTAGCTTCTAGAGG + Intergenic
1116028583 14:39543250-39543272 TTGCCTCTTCCATCTTTTGGTGG + Intergenic
1116045443 14:39737244-39737266 TTGTCTCTTCTGGCTTTTGGTGG + Intergenic
1116056595 14:39871761-39871783 TTGCCTCTTCCAGCTTCTAGAGG - Intergenic
1116746534 14:48826800-48826822 TTGCTTCCTCCAGCTTCTGATGG - Intergenic
1117058057 14:51933038-51933060 TTGCCTCTTCCAGCTTCTGATGG - Intronic
1117059501 14:51947538-51947560 TTTCATTTTCTAGCTTCTGGAGG - Intronic
1117099466 14:52331771-52331793 TTGCTTCTTCCATCTGTTGGAGG - Intergenic
1117475953 14:56095319-56095341 TTGCCTCTTCCAGCCTCTGGTGG + Intergenic
1117845992 14:59912532-59912554 TTGCCTCTTTTAACTTCTGGTGG + Intergenic
1118409316 14:65461166-65461188 CTTCTTCTTTTAGCTTATGGTGG + Intronic
1118497475 14:66322586-66322608 TTGCCTCTTTTAGCTTCTGGTGG - Intergenic
1118626297 14:67662434-67662456 TTGTTTCTTCTACCTGGTGTTGG - Intronic
1118645441 14:67834125-67834147 TTGCCTCTTTCAGCTTTTGGTGG + Intronic
1118801738 14:69196041-69196063 TTGCCTCTTCTAGTTCCTGGTGG + Intronic
1119042252 14:71285591-71285613 TTGCTTCTTCCATCTTCTTGTGG + Intergenic
1119158770 14:72435631-72435653 TTGCTTTTTCTAGCTTCTCGAGG + Intronic
1119312654 14:73662597-73662619 TAGCCTCTTCCAGCTTCTGGTGG + Intronic
1119546354 14:75474725-75474747 TTGCTTTTTCCAGGTTTTGGAGG + Intergenic
1119637185 14:76283464-76283486 TTGCCTTTTCTAGCTTCTAGAGG - Intergenic
1119861990 14:77942790-77942812 TTGCCTTTTCTAGTTTGTAGAGG + Intergenic
1119920580 14:78442398-78442420 TGGCTTCTTCCAGCTTCTGGTGG - Intronic
1120072642 14:80121175-80121197 TTGCCTCTTTCAGCTTCTGGTGG + Intergenic
1120287791 14:82526723-82526745 TTGCCTCTTCCAGCTTTTGATGG + Intergenic
1120351195 14:83361040-83361062 TTGCTTTTTCCAGCTTCTAGAGG - Intergenic
1120424870 14:84334471-84334493 TTGCTTCTTCCAGCTTTTGGTGG + Intergenic
1120435138 14:84471902-84471924 CTTCCTCTTCTAGCTTCTGGTGG + Intergenic
1120607812 14:86601408-86601430 TTGGTTCTTATAGTTTGTTGTGG - Intergenic
1120811007 14:88803413-88803435 TCCCTTCTCCTAGCTTCTGGTGG - Intergenic
1121463472 14:94099528-94099550 TGCCTCCTTCTAGCTTCTGGTGG - Intronic
1121468797 14:94135694-94135716 CTGCCTCTTCTAGCATCTGGTGG - Intergenic
1121476609 14:94213714-94213736 TTGCTTCTTTCAGCTTTTGGTGG - Intronic
1121544616 14:94754343-94754365 TTGCTTCTTCCATCATCTGGTGG - Intergenic
1121553000 14:94816255-94816277 TGGCTTCCTCCAGCTTCTGGTGG - Intergenic
1121583740 14:95048889-95048911 TTGCTTCCTCCAGCTTCTAGAGG + Intergenic
1121658743 14:95618755-95618777 TTGCCTCTTCTAGCTCCTGGTGG + Intergenic
1121795603 14:96732850-96732872 TTGCCTGTTCCAGCTTCTGGCGG + Intergenic
1121992041 14:98567687-98567709 TTGTTTCTTCCATCTTCTGGTGG - Intergenic
1122849984 14:104522853-104522875 CTGCTTCCTCCAGCTTCTGGGGG + Intronic
1123677962 15:22731131-22731153 TTGCTGATTCTTGCTTATGGTGG + Intergenic
1124041485 15:26109683-26109705 CTGCCTCTTCCAGCTTCTGGTGG + Intergenic
1124330162 15:28805403-28805425 TTGCTGATTCTTGCTTATGGTGG + Intergenic
1124508821 15:30304966-30304988 TTGCTTCTTTCTGCTTCTGGTGG - Intergenic
1124734737 15:32233696-32233718 TTGCTTCTTTCTGCTTCTGGTGG + Intergenic
1125158199 15:36613690-36613712 CCGCTTCTTCTAGCTTTTGCAGG - Intronic
1125177118 15:36836934-36836956 TTGCCTCTTCTAGTTTCTGGTGG + Intergenic
1125368812 15:38948016-38948038 TTGCATCTTCCAGCTTCTGGTGG + Intergenic
1125555548 15:40581830-40581852 TTGCTGCTGCTGGCTTTTGGAGG + Intergenic
1126299624 15:47181779-47181801 TTGCCTCTTCCAGCTTCTGGTGG + Intergenic
1126518857 15:49565928-49565950 TTGCCTCTTCTGTCTTCTGGAGG - Intronic
1126681070 15:51202683-51202705 TTGCCTCTTTGAGCTTCTGGTGG - Intergenic
1126785358 15:52174160-52174182 TTGCTTTTTCCAGCTTCTTGGGG - Intronic
1126808218 15:52374681-52374703 TTGCCTCTTGCAGCTTCTGGTGG - Intronic
1126957606 15:53951625-53951647 TTGCTTAATCTAGCTAGTGGTGG + Intergenic
1127218339 15:56848744-56848766 TTGCCTCTTCCAGCTTTTGGTGG - Intronic
1127362502 15:58257069-58257091 TTGATTCTTCCAGCTTCTGGAGG - Intronic
1127556895 15:60096348-60096370 TTGCCCCTTCCAGCTTCTGGTGG + Intergenic
1127761108 15:62139942-62139964 TTGCCTTTTCTAGCTTCCGGAGG + Intergenic
1127796500 15:62442879-62442901 TTGCTTTTTCCAGCTTCTTGAGG + Intronic
1128520191 15:68370058-68370080 TTGGTTCTTCCAGCTTCTGGTGG - Intronic
1128595343 15:68941507-68941529 TTGCGTCTTCTAGTTTCTGGTGG + Intronic
1128877333 15:71213163-71213185 TTGCCTCTTCCAGCTTCTGGTGG + Intronic
1128879290 15:71228323-71228345 TGGCCTCTTCCAGCTTCTGGCGG - Intronic
1128892478 15:71343512-71343534 TTTCCTCTTCCAGCTTTTGGTGG + Intronic
1129046826 15:72742991-72743013 CTGCTTTTTCTAGCTTAAGGTGG - Intergenic
1129063392 15:72880346-72880368 TTGCCTCTTCCAGCTTCTGGTGG - Intergenic
1129068803 15:72933858-72933880 TGGCCTCTTGTAGCTTCTGGTGG - Intergenic
1129532824 15:76282322-76282344 TTTCCTCTTCCAGCTTCTGGTGG - Intronic
1129634550 15:77301198-77301220 TTGACTCTTCTAACTTCTGGTGG + Intronic
1129831658 15:78674939-78674961 TTGCCTCTTCCAGCTCCTGGGGG - Intronic
1130013092 15:80167292-80167314 TTGCTGCTTCCAGCTTCTGGGGG + Intronic
1130015393 15:80182092-80182114 TGGCCTCTTCCAGCTTCTGGTGG + Intronic
1130196386 15:81783745-81783767 TTGGTTCTTCCAGCTTCTGGTGG + Intergenic
1130397416 15:83514992-83515014 TTGCCTTTTCTAGCTTCTAGAGG - Intronic
1130711982 15:86292360-86292382 TTGCCTTTTCTAGCTTCTAGAGG - Intronic
1130801899 15:87273267-87273289 CTGCCTCTTCCAGCTTGTAGTGG - Intergenic
1130892301 15:88143348-88143370 TTGCCTCCTCCAGCTTCTGGTGG - Intronic
1130893848 15:88155344-88155366 TTGCCTCTTCCAGCTTCTAGAGG - Intronic
1130938033 15:88486619-88486641 TTGCCCCTTCCAGCTTCTGGTGG - Intergenic
1130962801 15:88674719-88674741 TTGTCTCTTCTAGCTTCTGGTGG + Intergenic
1131009850 15:89008124-89008146 TTGCCTCTTTCAGCTTTTGGTGG + Intergenic
1131916734 15:97274136-97274158 TTGCTTCTTCCCACTTCTGGAGG + Intergenic
1132119947 15:99168000-99168022 TCGAGTCTGCTAGCTTGTGGAGG + Intronic
1132258956 15:100404108-100404130 TTGCTGCTTCTAGCTTCTGGTGG - Intronic
1132266120 15:100472344-100472366 TTGTTTCTTCTATTTTGTGTGGG + Intronic
1132366837 15:101264058-101264080 TTGCCTCTTTCAGCTTCTGGTGG - Intergenic
1132367078 15:101265439-101265461 TTGCTTCTTTCAGCTTCTGGGGG + Intergenic
1132773622 16:1579410-1579432 TTGCCTCTTCCAGCATGAGGTGG - Intronic
1133334455 16:4997777-4997799 CTGCTTTTTCCAGCTTCTGGTGG + Intronic
1133351295 16:5102405-5102427 TTGCCTCTTCTGGCTTCTGGTGG - Intergenic
1133354395 16:5125323-5125345 TTGCCTCTTCTGGCTTCTGGTGG + Intergenic
1133474660 16:6108728-6108750 CTTCCTCTTCTAGCTTCTGGTGG + Intronic
1133533206 16:6674754-6674776 TTGCCTCTTGTAGCTTCTGCTGG - Intronic
1133550715 16:6852213-6852235 TCTATTCTTCTAGCTTGTAGTGG + Intronic
1133701627 16:8314718-8314740 TTGCCTCTTCCAGCTTCTGGTGG + Intergenic
1133892882 16:9897938-9897960 TTGCTGCTTCTATGTTGTTGAGG + Intronic
1133909955 16:10056756-10056778 CTGCATCTTCTAACTTCTGGTGG - Intronic
1133935368 16:10264887-10264909 TTGCCTCTCCCAGCTTCTGGTGG - Intergenic
1133962982 16:10510615-10510637 TTGCTTCTTCTAGCTCCTGGTGG - Intergenic
1134080752 16:11323432-11323454 TTGCTTCTTCCAGCTTCTGGTGG - Intronic
1134128295 16:11631329-11631351 TTGCTTCTTTCAGCTTCTGGTGG + Intronic
1134208538 16:12257190-12257212 TTGCTTGTTCTGGGTTCTGGGGG - Intronic
1134304744 16:13022026-13022048 TAGCCTCTTCCAGCTTCTGGTGG + Intronic
1134564632 16:15240595-15240617 TTGCCTCTTCCAGCTTCTGGTGG + Intergenic
1134737865 16:16516104-16516126 TTGCCTCTTCCAGCTTCTGGTGG - Intergenic
1134901693 16:17943831-17943853 TTGCCTCTTCCAGTTTCTGGTGG + Intergenic
1134929638 16:18196056-18196078 TTGCCTCTTCCAGCTTCTGGTGG + Intergenic
1135139075 16:19906509-19906531 TTGCCTCTTCCAGCTTCTGGGGG + Intergenic
1135325662 16:21523885-21523907 CTGCCTCTTCCAGCTTCTGGGGG - Intergenic
1135353112 16:21746630-21746652 TTGCTTTTTCTAGCTTCAAGAGG - Intronic
1135416120 16:22269227-22269249 TTGTTTCTTCGGGCTTCTGGGGG + Intronic
1135451599 16:22562753-22562775 TTGCTTTTTCTAGCTTCAAGAGG - Intergenic
1135593914 16:23727052-23727074 TTGCTTCTTCTAGATCATGGTGG + Intergenic
1135841159 16:25877590-25877612 TTGCCATTTCTAGCTTCTGGTGG - Intronic
1135913635 16:26583443-26583465 TTGCCTTTTCTAGCTTCTAGAGG + Intergenic
1136298277 16:29316237-29316259 TTCCTTCTCCCAGCTTCTGGTGG + Intergenic
1136839266 16:33525202-33525224 CTGCCTTTTCTAGCTTCTGGGGG - Intergenic
1137553095 16:49453874-49453896 TTGCCTCTTCCAGCTTCTGGTGG - Intergenic
1137899731 16:52253844-52253866 TTGCTTCTTGATGCTTCTGGGGG - Intergenic
1137938174 16:52655522-52655544 CTGCTTCTTCCAGCTTTTGCAGG - Intergenic
1138718295 16:59049006-59049028 TTGCTTCTTCCAGCTTTTGAGGG - Intergenic
1138778779 16:59757125-59757147 TTGCCTCTACCAGCTTCTGGTGG + Intergenic
1138885946 16:61079653-61079675 TTGCCTCTTCCAGCTTCTAGTGG - Intergenic
1139032404 16:62900890-62900912 CTGTTTCTTCCAGCTTCTGGTGG + Intergenic
1139297764 16:65918037-65918059 TTGCTCTGTCCAGCTTGTGGGGG - Intergenic
1139312369 16:66038407-66038429 TTGCCTCTTCAAGCTTCTGGTGG - Intergenic
1139562505 16:67752370-67752392 TTGCCTTTTCTAGCTTCTAGCGG - Intronic
1139947096 16:70648880-70648902 TTGCCTCTTCCAGCTCCTGGTGG + Intronic
1140657156 16:77152539-77152561 TTGTCTCTTCCAGCTTCTGGGGG - Intergenic
1140715778 16:77724139-77724161 TTGCCTCTTCCAGTTTCTGGTGG + Intronic
1140896019 16:79324915-79324937 TTGCCTCTTTGAGCTTCTGGTGG + Intergenic
1141015370 16:80444122-80444144 TTGCCTCTTCCAGCTTCTGGTGG - Intergenic
1141066133 16:80915555-80915577 TTGCCTCTTCCAGCTTCTAGAGG + Intergenic
1141216119 16:82025347-82025369 CTGCTTCTTTCAGCTTCTGGTGG + Intergenic
1141253612 16:82381045-82381067 TTGCTTCTTCCAGCTTCTGATGG + Intergenic
1141311856 16:82921300-82921322 TTGCTTCTTCCAGCTTCTGGTGG + Intronic
1141361402 16:83398312-83398334 TTGCCTCTTCCAGCTCCTGGTGG + Intronic
1141518167 16:84560068-84560090 CTGCCTCTTCTAGCTCCTGGTGG + Intergenic
1142023487 16:87799437-87799459 TTGCCCCTTCTAGCTCCTGGTGG - Intergenic
1142038674 16:87878527-87878549 CTGCCTCTTCCAGCTTCTGGGGG - Intergenic
1203149431 16_KI270728v1_random:1825487-1825509 CTGCCTTTTCTAGCTTCTGGGGG - Intergenic
1142884088 17:2902089-2902111 TCGCCTCTTCTAGCCTCTGGCGG + Intronic
1142986277 17:3696950-3696972 TTGTCTCTTCCAGCCTGTGGGGG - Intergenic
1143137818 17:4721549-4721571 ATGATTCTGTTAGCTTGTGGGGG + Intergenic
1143246603 17:5491489-5491511 TTGCCTCTTCCAGCTTGTGGGGG - Intergenic
1143267878 17:5653966-5653988 TTGCCTCTTCTAGCTTCTAAAGG - Intergenic
1143297495 17:5882490-5882512 TTGCCTCTTCTAGCTTTTGGTGG + Intronic
1143974251 17:10818503-10818525 TTGCTTTTTTCAGCTTCTGGAGG - Intergenic
1144520615 17:15950246-15950268 TTGCCTCTTCCAGCTTCTGGTGG - Intronic
1144739735 17:17575152-17575174 TTGCTTCTTCCAGCTTCTGGTGG + Intronic
1144755457 17:17677829-17677851 TTGCCTGTTCTAGCTTCTGGAGG + Intergenic
1146198393 17:30832441-30832463 TTCCTTCCTCTATCTTTTGGGGG + Intronic
1146456187 17:33011601-33011623 TTGCTTTTTCCAGCTTCTAGAGG - Intergenic
1146753209 17:35401009-35401031 TTGCTTTTTCCAGCTTCTAGAGG + Intergenic
1147454592 17:40529209-40529231 TTGCCTCTTCTAGATTCTGACGG - Intergenic
1148573944 17:48694816-48694838 TTGCCTCTTCAAGTTTCTGGTGG + Intergenic
1149018233 17:51933440-51933462 TTGCCTCTTCCAGCTTCTAGAGG - Intronic
1149294954 17:55253672-55253694 TTGCCTCTTCCAGCTTCTGTTGG - Intergenic
1149317264 17:55450203-55450225 TTGCCTCTTCTACCTTTTGGTGG - Intergenic
1149378606 17:56070299-56070321 TTGCCTCTTCCAGCTTCTGGTGG + Intergenic
1149420524 17:56506466-56506488 TTGCCTCTTCTAGCTTCTGGTGG - Intronic
1149445786 17:56712330-56712352 TTGCTTCTTCCAGCCTCTGGTGG - Intergenic
1149469892 17:56907949-56907971 TTGCTTCTTACAGTTTCTGGTGG - Intronic
1149509585 17:57229007-57229029 TTGCTTCTGCCAGGTTCTGGAGG + Intergenic
1149511870 17:57248876-57248898 CTGCTACATCTTGCTTGTGGAGG - Intergenic
1149646172 17:58243226-58243248 TTTCTTCTTCCAGCTTCTGGTGG + Intronic
1149874859 17:60222005-60222027 ATTCTTCTTGTAGCTTTTGGTGG - Intronic
1149911988 17:60575110-60575132 TTGCCTCTGCTAGCTTCTGGTGG - Intronic
1150292895 17:63991938-63991960 CTGCTTCTTCTAGCGTTCGGAGG + Intergenic
1150699877 17:67437420-67437442 TTGCCTCTTCCAGCTTCTGGTGG - Intronic
1150721473 17:67617670-67617692 TTGCCTCTTCCAGCCTCTGGTGG + Intronic
1150836479 17:68568633-68568655 TTGTTTCTCTTAGCTTATGGTGG + Intronic
1150854639 17:68740358-68740380 CTGCCTCTTCCAGCTTCTGGTGG + Intergenic
1150932906 17:69604338-69604360 CTGCATCTTCCAGCTTCTGGTGG + Intergenic
1150996564 17:70324738-70324760 TTGCTTTATCTAGCTTATAGTGG + Intergenic
1151271089 17:72996504-72996526 TTGCATCTTCCAGCTGTTGGTGG + Intronic
1151285551 17:73108472-73108494 TTGCCTCTTCTGGCTTCTGGCGG - Intergenic
1151392300 17:73795573-73795595 TTGCCTCCTCCAGCTTCTGGTGG + Intergenic
1151432386 17:74072293-74072315 TTGCCTCTTCCAGCTCCTGGGGG + Intergenic
1151487597 17:74411069-74411091 TTGCCTCCTCCAGCTTCTGGGGG - Intergenic
1151488227 17:74415631-74415653 TTGTCCCTTCCAGCTTGTGGTGG - Intergenic
1151517253 17:74604613-74604635 TTGCCTTTTCCAGCTTCTGGAGG + Intergenic
1151874137 17:76856958-76856980 TTCCTCCTCCTAGCTTGAGGGGG + Intergenic
1151953747 17:77370278-77370300 TTGCCTCTTCCAGCTTCTGGTGG + Intronic
1151986272 17:77545975-77545997 TTGCTGTTTCCAGCTTCTGGAGG - Intergenic
1152000536 17:77642509-77642531 CTGCCTCTTCCAGCTTCTGGTGG + Intergenic
1152025871 17:77808932-77808954 TTGCTTCTTCCAGTTTTTGCCGG - Intergenic
1152211761 17:79006196-79006218 ATGCCTCTTCCAGCTTCTGGAGG + Intronic
1152395387 17:80029902-80029924 TTGCTTTTTCCAGCTTCTAGAGG + Intronic
1153038175 18:784624-784646 TTGCCCTTTCTAGCTTGTGGGGG + Intronic
1153117661 18:1679086-1679108 TTGCTTTTTCCAGCTACTGGAGG + Intergenic
1153732948 18:8033927-8033949 TTGCTTCTTCTAGCTTCTGGTGG + Intronic
1154514270 18:15144616-15144638 TTGCCTCTTCCAGCTTTTGGTGG - Intergenic
1154989957 18:21591313-21591335 TTGCCTCATCTAGCTTCTGTTGG - Intronic
1155061275 18:22231049-22231071 TTGCTTCTTCAAACTGCTGGTGG + Intergenic
1155077994 18:22379623-22379645 TTGCTCCTTCCAGCTTCTGGTGG - Intergenic
1155126203 18:22878680-22878702 TTGCCTTTTCCAGCTTGTGGAGG + Intronic
1155267947 18:24112120-24112142 TTGCCTCTTCCAGCCTCTGGTGG + Intronic
1155409141 18:25523004-25523026 ATGCCTCTTGTAGCTTCTGGTGG - Intergenic
1155621299 18:27783733-27783755 TTGCCTCTTTCAGCTTCTGGTGG - Intergenic
1156103597 18:33629098-33629120 TTACTTCTTTTGGCGTGTGGGGG - Intronic
1156174895 18:34532498-34532520 TTGCTTCTTACAGCAAGTGGTGG - Intronic
1156177642 18:34565576-34565598 TTGCCTCTTCTAGCTTCTGATGG + Intronic
1156193068 18:34742388-34742410 TTGCCACTGCTAGCTTCTGGAGG + Intronic
1156249571 18:35339742-35339764 TTGCTTGTTCTCACTGGTGGGGG - Intronic
1156571095 18:38254127-38254149 TTGCTCCTTCTAGCTTCTGGTGG - Intergenic
1156841112 18:41610597-41610619 TTGCATCTTCCAGCTTTGGGTGG + Intergenic
1156851901 18:41738147-41738169 TTGCTTCTTCCAGTTTCTTGTGG - Intergenic
1156854807 18:41769206-41769228 TTGCCTCTTATAGCTTCTGATGG - Intergenic
1157755086 18:50210564-50210586 TTGCCTCTTCCAGCTTCTGGGGG + Intergenic
1157932123 18:51834628-51834650 TTGTCTCTTCCAGCTTCTGGTGG + Intergenic
1157945199 18:51971523-51971545 TTGATTCTTGTAGATTCTGGTGG - Intergenic
1158146741 18:54322838-54322860 TCACTTCTTCCAGCTTCTGGTGG + Intergenic
1158309563 18:56143855-56143877 TTGACTCTTCCAGCTTCTGGTGG + Intergenic
1158406113 18:57161171-57161193 CTGCGTCTTCCAGCTTTTGGCGG - Intergenic
1158424695 18:57328330-57328352 TTGCTTTTTCTAGCTTCTAGAGG + Intergenic
1158483358 18:57842680-57842702 TTGCCTCTCTTAGCTTCTGGTGG + Intergenic
1158534617 18:58296523-58296545 TTGCTTCCTCCAGCTTCTGGGGG + Intronic
1158565542 18:58551306-58551328 TTGCCTCTTCCAGCTTCTGGTGG + Intronic
1158687454 18:59627706-59627728 TTGCTGCTTCCAGCGTCTGGGGG - Intronic
1158696451 18:59708376-59708398 TTGATTTTTCTAGCTTCTGGAGG + Intergenic
1158722998 18:59942534-59942556 TTGCCTCCTCTAGCTCTTGGTGG - Intergenic
1159118033 18:64137230-64137252 TTGCCTCTTCCAGCTTCTGGTGG - Intergenic
1159201764 18:65195600-65195622 TTGCTTCCTCCAGCTTCTGGTGG + Intergenic
1159444428 18:68523725-68523747 TGGTCTCTTCTAGCTTCTGGTGG - Intergenic
1159950121 18:74476736-74476758 TTGCTTCTTCCGGCTTCTGAAGG - Intergenic
1160070676 18:75625201-75625223 TTGCCTCTTCCAGCTTCTGGTGG - Intergenic
1160109614 18:76013775-76013797 TTGAGTCTTCCAGCTTCTGGGGG + Intergenic
1160135980 18:76272285-76272307 TGGCTTCTTCTGGCTTCAGGTGG + Intergenic
1160688424 19:448360-448382 CTGCCTCTTCCAGCTTCTGGGGG + Intronic
1161292647 19:3503445-3503467 CTGCCTCTTCCAGCTTCTGGGGG + Intergenic
1161927251 19:7310394-7310416 TTGCTTCTTCTCACTTCTGGTGG - Intergenic
1162539686 19:11287196-11287218 TTGCCTCTTCCAACTTCTGGTGG + Intergenic
1162823422 19:13236798-13236820 CTGGTTCTTCTAGCTTGGGTGGG - Intronic
1162942541 19:14021719-14021741 TTGCCTCTTCCAGCTTCTGGAGG + Intergenic
1162968699 19:14167639-14167661 TTGCTTCTTCTGGGTTGTGAGGG - Intronic
1163418087 19:17198779-17198801 CTGCCTCTTCTGGCTTTTGGGGG + Intronic
1163755280 19:19102957-19102979 TTGCTTCTTCCGGCTTCTGGGGG + Intronic
1164810367 19:31150289-31150311 TTGCTTCTTTCAGCTTGCAGTGG + Intergenic
1165185334 19:34015737-34015759 TTGTTTCTTCCAGCTTGTTGAGG - Intergenic
1165279491 19:34784158-34784180 TTGCTTCTTCCAGCTTCTGGTGG + Intergenic
1165375522 19:35439056-35439078 TTGCCTCTTCCAGCTTCTGGTGG + Intergenic
1165882710 19:39054824-39054846 TTGCCTCTCCTGGCTTCTGGAGG + Intergenic
1165995207 19:39839142-39839164 TTGCTGCTGCTAGCTTGGAGCGG + Exonic
1166212000 19:41312705-41312727 TTGCCTCTTCCAGCCAGTGGTGG + Intronic
1166949935 19:46420289-46420311 TTGCCTCTTCAAGCTTCCGGTGG - Intergenic
1166964652 19:46521553-46521575 TTGCCTCCTCCAGCTTCTGGGGG - Intronic
1167401692 19:49275992-49276014 TTGCATTTTCAGGCTTGTGGTGG + Intergenic
1167533506 19:50033738-50033760 TTGCCTCTCCCAGCTTCTGGAGG + Intronic
1167761075 19:51449671-51449693 TGGCGTCTTCTAGCTTCTGGGGG + Intergenic
1167791178 19:51683147-51683169 TTTCTTGTTCTAGCTTCTGGTGG + Intergenic
1168453988 19:56490645-56490667 TTGCCTTTTCTAGCTTCTAGAGG - Intergenic
1168661603 19:58171812-58171834 TTGCCTCTTCCAGCTTATGGTGG + Intergenic
1168691251 19:58378895-58378917 TTGCCTCTTCCGGCTTCTGGCGG - Intronic
1168716805 19:58533490-58533512 TTGCTTCTTCCAGTTTCTGGTGG - Intronic
925302946 2:2829879-2829901 CTGCCTCTTCTAGCTTCTGGGGG - Intergenic
925828224 2:7871425-7871447 TGGCCTCTTCCAGCTTTTGGTGG - Intergenic
926307973 2:11653286-11653308 TTGCTTCTTCCAGCTTCCGATGG - Intergenic
926455182 2:13058466-13058488 ATGCCTCTTCCAGCTTCTGGTGG + Intergenic
926614022 2:14976839-14976861 TTGCCTCTTCCAGTTTCTGGTGG - Intergenic
926746349 2:16161516-16161538 TTGCCCCTTCCAGCTTTTGGTGG - Intergenic
926874403 2:17458600-17458622 TTGCTTCTTCCAGCTTCTGATGG - Intergenic
927224748 2:20752806-20752828 TTGCTTCTTCCAGCTTCTGATGG + Intronic
927966710 2:27275050-27275072 TTGGGTCTTCCAGGTTGTGGAGG + Intronic
927987184 2:27420240-27420262 TTGCCTTTTCTAGCTTCTAGAGG + Intergenic
928194505 2:29205585-29205607 CTCCTTCTTCTGGCTTCTGGTGG + Intronic
928308102 2:30187805-30187827 TTGCCTATTTTAGCTTCTGGTGG - Intergenic
928342309 2:30455491-30455513 TTGCCTCTTCTAGCTTCTGGTGG + Intronic
928620727 2:33085146-33085168 TTGCCTCTTCCAGCTTCTAGGGG - Intronic
928680639 2:33699155-33699177 CTGCATCTTCCAGCTTATGGTGG - Intergenic
928884401 2:36131609-36131631 GAGCTTCTTCTAGCTGCTGGAGG - Intergenic
929049802 2:37826418-37826440 TTGCCTCTTCCAGCTTTTGCTGG + Intergenic
929627300 2:43422501-43422523 TTGCTGCTTCCAGATAGTGGAGG - Intronic
929854836 2:45628064-45628086 TTGCCTCTTCCAGCTTGTGGTGG + Intergenic
930064340 2:47316240-47316262 TTGCCTCTGCTGGCTTCTGGTGG + Intergenic
930192839 2:48478107-48478129 TTGCCTCTTCCAGCTTCTGTTGG - Intronic
930734680 2:54764515-54764537 CTGCTTCTTGTTGCTTGTGTAGG + Intronic
930809437 2:55525304-55525326 TAGCTTGTTGTAGGTTGTGGTGG + Intronic
930926397 2:56823153-56823175 TTGCCTCTTCCAGCTTTTAGTGG - Intergenic
930968204 2:57358563-57358585 TTTCTTTTTCTAGCATTTGGAGG - Intergenic
931034125 2:58217386-58217408 TTGCCTCTTCCAGTTTCTGGTGG + Intronic
931214258 2:60226591-60226613 TTGCTTCTTACAGCCTTTGGTGG + Intergenic
931271930 2:60711151-60711173 CTGCTGCTTCCAGCTTCTGGTGG + Intergenic
931369417 2:61648520-61648542 TTGCTTCTTCCAACTTCTGTTGG + Intergenic
931386135 2:61799192-61799214 TTGCCTCTTCTGGCTTCTGATGG - Intergenic
931585003 2:63816561-63816583 TTTCTTCTTCCAGCTTCTGGTGG - Intronic
931957589 2:67444718-67444740 TGGCCTCTTCTAGCTTCTGGTGG + Intergenic
932023044 2:68107592-68107614 TTGCCTTTTCTAGCTTCTAGGGG + Intronic
932047418 2:68363826-68363848 GTGCCTCTTCCAGCTTCTGGGGG + Intergenic
932226931 2:70048799-70048821 TTGTCTCTTCTAGTTTCTGGTGG + Intergenic
932484084 2:72070746-72070768 TTGCCTCTTCTGGCTTCTGGTGG - Intergenic
932849281 2:75168528-75168550 TTGCTTTTTCTAGCTTCTAGAGG - Intronic
932900830 2:75697864-75697886 TTGACTCTTCTAGTTTCTGGTGG - Intronic
933142950 2:78816400-78816422 TTGGCTCTTCTGGCTTCTGGTGG - Intergenic
933255000 2:80070818-80070840 TTTCTTCTTCCAGCTGCTGGTGG + Intronic
933563062 2:83913302-83913324 TTGCCTCTTCCAGTTTCTGGAGG - Intergenic
933574213 2:84048866-84048888 TGGCTTCTTCCAGCTTCTGGTGG - Intergenic
933616180 2:84484530-84484552 TTGCCTCTTCTGGCTTCTAGAGG + Intergenic
933845725 2:86325664-86325686 TTGCTTCTTCCAGCTTCTGGTGG - Intronic
933871889 2:86574449-86574471 TTGCCTCATCCAGCTTCTGGTGG - Intronic
934054318 2:88239370-88239392 TTGCCTCTTCCAGCTTCTGATGG + Intergenic
934164096 2:89278650-89278672 TTGCCTCTTTCAGCTTCTGGTGG - Intergenic
934169091 2:89324459-89324481 TGGCTTCTTCCAGCTTTTGGTGG + Intergenic
934198202 2:89858125-89858147 TGGCTTCTTCCAGCTTTTGGTGG - Intergenic
934203178 2:89903874-89903896 TTGCCTCTTTCAGCTTCTGGTGG + Intergenic
934790617 2:97056751-97056773 TTACTTCTTTGAGCTTTTGGTGG - Intergenic
934819400 2:97359061-97359083 CTGCCTCTTCCAGCTTCTGGTGG + Intergenic
935494122 2:103757652-103757674 TTGTCTCTTCCAGCTTCTGGTGG + Intergenic
935591226 2:104846902-104846924 TTGATTCTTTGAGGTTGTGGTGG - Intergenic
935692173 2:105741981-105742003 CTGCCTCTTCCAGCTTCTGGTGG - Intergenic
935747645 2:106203078-106203100 TAACTTCTTCTGGCTTGTGAAGG - Intergenic
935786052 2:106549908-106549930 CTGCCTCTTCCAGCTTCTGGAGG + Intergenic
936267939 2:111024465-111024487 TTTCCTCTTCTGGCTTCTGGTGG - Intronic
936285876 2:111181033-111181055 TTGCCACTTCCAGCTTCTGGTGG + Intergenic
936522175 2:113218216-113218238 TTGCTTCTTCTCTCCTTTGGTGG + Exonic
936974453 2:118205225-118205247 TTCTCTCTTCTACCTTGTGGTGG + Intergenic
937104718 2:119299611-119299633 TTGCCTCTTCTAGTTTCTGGTGG + Intergenic
937488795 2:122343812-122343834 TTGCCTCTTCTACCTTCTTGTGG - Intergenic
937549159 2:123065406-123065428 TTGCCTCTTCCAGCTTCTGATGG - Intergenic
937645019 2:124257076-124257098 TTTCTTCTCCTAGCTTCTAGAGG - Intronic
938316621 2:130333773-130333795 CTGCTTGTCCTAGCTTCTGGTGG - Intergenic
938412858 2:131079575-131079597 TTGCATCTTCTAGTTTCTGGTGG - Intronic
938514512 2:131989226-131989248 TTGCCTCTTCCAGCTTTTGGTGG - Intergenic
938624153 2:133090498-133090520 TTGCCTCTTTTAGCTTCTGGTGG - Intronic
938636086 2:133227908-133227930 TTGCTTCTCCTAGAGTTTGGTGG - Intronic
938705774 2:133924238-133924260 TTGCCTTTTCTAGCTTGTAGAGG - Intergenic
938728640 2:134129175-134129197 TTGCCTTTTCTAGCTTCTAGAGG + Intronic
938738330 2:134206802-134206824 TTGCCTCTTCCAGCTTCTGGTGG - Intronic
938789572 2:134664712-134664734 TTGCCCCTTCCAGCTTCTGGTGG - Intronic
938945875 2:136211637-136211659 TTGCTCCTTCTACCATGTGAAGG - Intergenic
938960246 2:136334349-136334371 CTGACTCTTCTAGCTTCTGGTGG + Intergenic
939021415 2:136962185-136962207 TTGCTTTTTTCAGCTTGTAGAGG - Intronic
939135221 2:138285620-138285642 TTGCTACTTTCAGCTTCTGGTGG + Intergenic
939140916 2:138353713-138353735 TTGCCTCTTCTAGGCTTTGGTGG - Intergenic
939161991 2:138601693-138601715 TTTCCTCTTCCAGCTTTTGGTGG - Intergenic
939194634 2:138956710-138956732 TTGCCTCTTCTAGTTTCTGGTGG + Intergenic
939346413 2:140971320-140971342 TTGCTTTTTTCAGCTTCTGGTGG - Intronic
939469265 2:142598858-142598880 TTGCTTTTTCAAGCTTGGGGTGG + Intergenic
939548266 2:143581175-143581197 TTGCATCTTCTGGCTTTTTGTGG - Intronic
939702587 2:145412007-145412029 TTGTTTGTTGTAGCTTGTGTAGG + Intergenic
939748061 2:146003160-146003182 TTGCCTTTTCCAGCTTCTGGTGG + Intergenic
940041819 2:149369208-149369230 TTGCTTGAGCTAGCTTGTGTTGG - Intronic
940073465 2:149715420-149715442 TTGTTTCTTCCAGTTTCTGGTGG + Intergenic
940092993 2:149943004-149943026 TTGCCTCTTCCAGCTTCTGATGG + Intergenic
940149285 2:150581329-150581351 GTACTTCTTCCAGCTTCTGGTGG - Intergenic
941856843 2:170239949-170239971 TTGCCTCTGCCAGCTTCTGGTGG + Intronic
941868966 2:170363731-170363753 TTGCTTCCTTTATCTTCTGGTGG + Intronic
941992764 2:171573087-171573109 TTCCTTCTTCCAGCTTCTGGTGG - Intergenic
942398845 2:175580277-175580299 CTGCCTTTTCTAGCTTCTGGTGG + Intergenic
942406253 2:175659705-175659727 TTGCCTCTTCCAGCTTCTGGTGG - Intergenic
942421201 2:175809827-175809849 TTGCTTCTTCCAGCTTGTGGTGG + Intergenic
942877214 2:180815130-180815152 TTGCCTCTTCTAGCCTTTGGTGG - Intergenic
942980856 2:182079776-182079798 TTGCCTCTTCCAGTTTCTGGTGG + Intronic
943199611 2:184803738-184803760 TTACCTCTTCTAGCTTCTGATGG + Intronic
943380550 2:187139743-187139765 TTGTCTCTTCCAGCTTCTGGTGG + Intergenic
943692949 2:190887332-190887354 TTGCTTCTACTACGTTGTAGGGG - Intronic
944248390 2:197556618-197556640 TTGCTTCTTTTAGCTTCTGGTGG + Intergenic
944345541 2:198660904-198660926 TTGCTTCTTCCACCTTCTGGGGG + Intergenic
944863686 2:203839940-203839962 TTGTTTCTTCCAGCTTCTGGTGG + Intergenic
944904029 2:204244681-204244703 TTGTTTCTTCCAGCTTCTGCTGG + Intergenic
945060889 2:205907845-205907867 TTGCCTCTTCCATCTTCTGGTGG + Intergenic
945218520 2:207460818-207460840 TTGATTCCTCAAGCTTGTAGGGG - Intergenic
945335543 2:208588583-208588605 TTGCTTCCTCCCGCTTCTGGTGG - Intronic
945471700 2:210234470-210234492 TTGCCTCTTCTAGCTTCTGGTGG - Intergenic
945571472 2:211473256-211473278 TTGCTTCTTCCAGCTTCCAGTGG - Intronic
946001647 2:216487243-216487265 TTGCTTCTCCCAGCTTGCTGAGG + Intergenic
946808052 2:223492014-223492036 TTGCATTTTCTAGCTTCTAGAGG + Intergenic
946974444 2:225132412-225132434 TTACCTCTTTTAGCTTCTGGTGG + Intergenic
947186598 2:227460888-227460910 TTGCCTCTTCCAGTTTCTGGTGG + Intergenic
947287180 2:228529963-228529985 TAGCTCCTTCTAGCTTCTGGTGG - Intergenic
947338009 2:229107128-229107150 TTGCCTCTTCCAGCTTCTGGTGG - Intronic
947583151 2:231334352-231334374 TTGCCTCTTCCAGCCTCTGGTGG + Intronic
947618714 2:231575108-231575130 TTGACTCTTCTAGCTTCTGGTGG + Intergenic
947815898 2:233036567-233036589 CTGCTTCTTCCAGCTTCTGCCGG + Intergenic
947910065 2:233794918-233794940 TTGCCTCTTCCAGCTTCTGGTGG + Intronic
948121021 2:235530535-235530557 TTGCTTTTTCCAGCTTCTAGAGG + Intronic
948243450 2:236457781-236457803 TTGCCTCTGCCAGCTTCTGGGGG - Intronic
948286512 2:236790109-236790131 CTGCTTCTTCCAGCTCCTGGTGG - Intergenic
948295229 2:236855614-236855636 TTGCTTTTTTCAGCTTTTGGAGG + Intergenic
948329434 2:237153390-237153412 TTGCCTTTTCCAGCTTCTGGGGG + Intergenic
948504864 2:238421930-238421952 TTGCCTCTGCCAGCTTCTGGGGG + Intergenic
948517360 2:238512119-238512141 TTGCCTCTTCTGGCTCCTGGGGG - Intergenic
948665228 2:239530389-239530411 CTGCCTCTTCCAGCTTCTGGCGG - Intergenic
1168914331 20:1473989-1474011 TTGATTCTTCCAGCTTCTGGTGG + Intronic
1168924515 20:1568152-1568174 TTTCTTCTTTTGGCTTGGGGAGG - Intronic
1169517902 20:6337702-6337724 TTGCCTCTTCCAGCTTCAGGTGG - Intergenic
1169724987 20:8718460-8718482 TTGCTTTTTCCAGCTTCTAGAGG + Intronic
1169729228 20:8768259-8768281 TTGTTTCTTCTAACTTCTGGTGG + Intronic
1169823836 20:9744074-9744096 TTGCTTCTTCCAGCTTCTGGTGG - Intronic
1169947629 20:11006360-11006382 TTGCCTCTTCCAACTTCTGGTGG + Intergenic
1170513267 20:17101398-17101420 TTGCCTCTTCTAGATTCTGGTGG - Intergenic
1170536243 20:17343823-17343845 TTGCCTTTTCCAGCTTCTGGAGG - Intronic
1170750891 20:19143824-19143846 TTGCCTCTTCTAGCTTCTGTGGG - Intergenic
1170750897 20:19143859-19143881 ATGCTCCCTCTAGCTTATGGGGG - Intergenic
1170773718 20:19357241-19357263 TTCCTTCTTAGAGCTTCTGGAGG + Intronic
1171025403 20:21625536-21625558 TTGCCTTTTCCAGCTTCTGGAGG + Intergenic
1171216024 20:23352900-23352922 TTGCTGCTTCTAGCTTATCATGG + Intronic
1173003963 20:39125493-39125515 TTGCCTCTTCTAGCTTCTGGTGG + Intergenic
1173041301 20:39465840-39465862 TTGCCTCTTCTAGCTTGCTGTGG + Intergenic
1173058584 20:39639892-39639914 TTGCCTCTTCTAGCTTCTGGTGG - Intergenic
1173129513 20:40376616-40376638 TTGCCTTTTCTAGCTTCTAGAGG - Intergenic
1173135415 20:40434681-40434703 TTTCTTCTTCCAGCTACTGGTGG - Intergenic
1173155717 20:40606868-40606890 TTGCCTTTTCCAGCTTCTGGGGG + Intergenic
1173189284 20:40863750-40863772 TTGCCTCCTCCAGCTTCTGGTGG - Intergenic
1173540142 20:43844879-43844901 TTGCCTCCTCCAGCTTCTGGTGG - Intergenic
1173703255 20:45091826-45091848 TTTTCTCTTCTAGTTTGTGGTGG - Intergenic
1173888060 20:46479192-46479214 TTGCCTTTTCTTGCTTCTGGAGG + Intergenic
1173908334 20:46645086-46645108 TTGCCTGTTCCAGCTTCTGGAGG + Intronic
1174124079 20:48289816-48289838 TTGCCTCTTCTGGCTTCTAGAGG - Intergenic
1174144013 20:48438210-48438232 TTGCTTCCTCTAGCTGCAGGTGG + Intergenic
1174333780 20:49842878-49842900 TTGCATCTTCCAGCTTCTGGTGG + Intronic
1174435650 20:50504988-50505010 TTTCCTGTTCTAGCTTCTGGTGG - Intergenic
1174661078 20:52213777-52213799 TTGCCTTTTCCAGCTTCTGGAGG + Intergenic
1174673729 20:52333014-52333036 TCGCCTCTTCCAGCTTCTGGTGG + Intergenic
1174728868 20:52894537-52894559 TTGCTTCCTCTAGCTTCTGCTGG - Intergenic
1175002848 20:55648423-55648445 TTGCCTCTTCCAGCTTCTTGTGG - Intergenic
1175019923 20:55835023-55835045 TTGCCTTTTCTGGCTTATGGAGG + Intergenic
1175110530 20:56644906-56644928 TTGCTTCTTCCAGCTTCTGGTGG - Intergenic
1175132148 20:56797388-56797410 TTGCCTCTTCCAGCTTCTGATGG + Intergenic
1175214843 20:57386633-57386655 TTGCTTCTCCTGGCCTCTGGTGG + Intergenic
1175364402 20:58442027-58442049 GTGCTTCTTTTGGCTTGTGGTGG + Intronic
1175492599 20:59389341-59389363 TGGCCTCTTCCAGCTTCTGGTGG + Intergenic
1175508549 20:59505161-59505183 TTGCTTTTTCCAGCTCCTGGAGG + Intergenic
1175582986 20:60114801-60114823 TTGCCTCTTCCAGCTTCTGGTGG - Intergenic
1176378414 21:6098830-6098852 ATGCCTCTTCCAGCTTCTGGAGG - Intergenic
1176424657 21:6540797-6540819 TTGCCTCTTCCAGCTTTTAGAGG + Intergenic
1176513577 21:7766887-7766909 TTGCCTCTTCCAGCTTCTGGTGG - Intronic
1176671979 21:9743857-9743879 TTGCCTCTTCCAGATTCTGGTGG + Intergenic
1176779260 21:13173674-13173696 TTGCCTCTTCTAGCTTTTGGTGG + Intergenic
1176903880 21:14476806-14476828 TTGCCTCTTCCAGCTTCTGGTGG + Intergenic
1177442128 21:21139244-21139266 TTGCCTCTTACAGCTTCTGGTGG - Intronic
1177489016 21:21797281-21797303 TTGTTTCTTCTAGCTCCTGGTGG - Intergenic
1177543959 21:22532872-22532894 TGCCTTTTTCTAGCTTCTGGTGG - Intergenic
1177976903 21:27862706-27862728 TTGCCTCTTCCAGCTTTTGGTGG + Intergenic
1178010263 21:28276898-28276920 TTGCCTTTTCCAGCTTCTGGAGG - Intergenic
1178055508 21:28793888-28793910 TTGCCTCTTTCAGCTTCTGGTGG - Intergenic
1178142804 21:29702787-29702809 TTGCTTCCTCCAGCTTCTGGTGG - Intronic
1178308168 21:31508108-31508130 TTCCCTCTTCCAGCTTCTGGTGG - Intronic
1178313022 21:31545272-31545294 TTGCCTCTTCCAGCTTTTGGTGG - Intronic
1178325495 21:31642133-31642155 TTGCCTCTTCTAGCTTCTGGTGG - Intergenic
1178374311 21:32054409-32054431 TTGCCTCTTCCAGCTTCTGGTGG + Intergenic
1178506460 21:33167000-33167022 TGGCCTCTTCCAGCTTCTGGAGG - Intronic
1178647690 21:34397411-34397433 TTGCCTCTTCCAGCTTCTGGTGG - Intronic
1178773452 21:35527226-35527248 TTGCCCCTTCTACCCTGTGGGGG + Intronic
1179026356 21:37682274-37682296 TTGCTTCTTCTGGCTTCTCAGGG + Intronic
1179031800 21:37727116-37727138 TTGCCTCTTCCAGCTTCTGTTGG - Intronic
1179169180 21:38959514-38959536 TTGCCTCTTCCAGCTTCTGGTGG - Intergenic
1179217136 21:39377338-39377360 TTGCTTTTTCCAGCTTCTAGAGG - Intergenic
1179268903 21:39832864-39832886 TTGTCTCTTCCAGCTTCTGGTGG - Intergenic
1179310515 21:40191760-40191782 TTGCCTCTTCCAGCTTCTGGTGG + Intronic
1179344547 21:40544590-40544612 TTGCCTCTTCCAGTTTCTGGTGG - Intronic
1179379127 21:40882054-40882076 TTCCTCCTTCTAGCTCTTGGAGG - Intergenic
1179593845 21:42429159-42429181 TTGCTTCTTCCAGCTCCTGGTGG - Intronic
1179628952 21:42665181-42665203 TTGCCTCTTCCAGCTTCTAGGGG - Intronic
1179629791 21:42669269-42669291 TTGCCTCTTCCAGCTGCTGGTGG + Intronic
1179700146 21:43149106-43149128 TTGCCTCTTCCAGCTTTTAGAGG + Intergenic
1179720142 21:43311636-43311658 TTGCTTATTCCAGCTCCTGGTGG + Intergenic
1179745059 21:43439402-43439424 ATGCCTCTTCCAGCTTCTGGAGG + Intergenic
1179927398 21:44543734-44543756 TTGCTCCTTCTAGCTTCTGGTGG - Intronic
1180007345 21:45028824-45028846 CTGCCTCTTCTGGCTTCTGGAGG + Intergenic
1180747400 22:18099745-18099767 TTGTTTCTTCCAGCTTCTGCTGG + Exonic
1181878353 22:25957692-25957714 TTGCCTCTTCCAGCTTCTGATGG + Intronic
1182046319 22:27276996-27277018 TTGCTTTTTTCAGCTTCTGGAGG - Intergenic
1182049520 22:27302143-27302165 TTGCCTTTTCCAGCTTCTGGTGG - Intergenic
1182517321 22:30866328-30866350 TTGCCTTTTCTAGCTTCTGCAGG - Intronic
1182821760 22:33222679-33222701 TTGCCTCTTCCAGTTTCTGGTGG - Intronic
1182960085 22:34463793-34463815 TTGATTCTGCTACCTTTTGGGGG - Intergenic
1183002565 22:34873816-34873838 ATGCCTCTTCCAGCTTCTGGTGG + Intergenic
1183170227 22:36182449-36182471 TTGCCTCTTCCAGCTCTTGGAGG + Intergenic
1183277367 22:36907605-36907627 TGCCTTCTTCCAGCTTCTGGTGG + Intergenic
1183389927 22:37539809-37539831 TTGCCTCTTCCCGCTTCTGGTGG - Intergenic
1183397092 22:37577884-37577906 TTGCCTCTTCCAGCTTCTGGTGG - Intronic
1183930519 22:41233592-41233614 TTGCCTCTTCCAGCTTCTGGTGG - Intronic
1184009461 22:41736094-41736116 CTGCCTCTTCCAGCTTCTGGTGG + Intronic
1184125113 22:42481426-42481448 TCACCTCTTCTAGCTTCTGGTGG + Intergenic
1184133325 22:42530887-42530909 TCACCTCTTCTAGCTTCTGGTGG + Intergenic
1184283954 22:43456008-43456030 TTGCCTCTTGTAGCTTGTGGTGG + Intronic
1184419512 22:44371498-44371520 TTGCTTCTTGCAGCTCCTGGTGG - Intergenic
1184543934 22:45152614-45152636 TTGCCTCTTCCAGCTTCTGGTGG - Intergenic
1184801715 22:46764808-46764830 TTGCCTCTTCTAGCTTCTGGTGG - Intronic
949092247 3:42074-42096 TGGCTTTTTCTAGCTTTTAGAGG + Intergenic
949093691 3:60713-60735 TTGCCTCTTCCAGCTTCTGGTGG - Intergenic
949280377 3:2339910-2339932 TTGCTTCCTCTAGCTTCTGGTGG + Intronic
949316049 3:2756783-2756805 CTGCTTCTTCTAGCTTCTGGTGG - Intronic
949458095 3:4260880-4260902 TTGCCTTTTCTAGCTTCTAGAGG - Intronic
949720034 3:6978270-6978292 TTGACTCTTCCAGCTTCTGGTGG - Intronic
949907078 3:8866619-8866641 TTGCTTTTTCTAGCTGCTAGGGG - Intronic
951035928 3:17931818-17931840 TTGCCTTTTCCAGCTTCTGGTGG + Intronic
951057784 3:18168059-18168081 TTGCTTTTTCCAGCTTTTAGAGG + Intronic
951212947 3:19995421-19995443 TTGGGTCTTCCAGCTTATGGTGG - Intronic
951316562 3:21194259-21194281 TTGCTCCTTCTAGCTCCTGGAGG - Intergenic
951429772 3:22592936-22592958 TTACTTCTTCCACCTTCTGGTGG + Intergenic
951532073 3:23707158-23707180 CTGCCTCTTCCAGCTTCTGGTGG + Intergenic
951534865 3:23731294-23731316 CTGCTTCTTCCAGTTTCTGGTGG + Intergenic
952193634 3:31049640-31049662 TTGCCTCTTCTAGCCTCAGGTGG + Intergenic
952488622 3:33842568-33842590 TTGCTGATTCTTGCTTATGGTGG + Intronic
952522888 3:34179756-34179778 TTGCCTGTTCTAGCTTCTGGTGG - Intergenic
952647677 3:35681400-35681422 TTGCTTCTTCTACTCTGTAGTGG + Intronic
952928071 3:38336426-38336448 TTGCCTCTTCCTGCTTCTGGTGG + Intergenic
953366764 3:42351934-42351956 TTGCCTTTTCTAGCTTCTAGAGG + Intergenic
953453482 3:43023261-43023283 TTGCCTCTTCCAGCTTTTGGTGG - Intronic
953458685 3:43064028-43064050 GTGCTTCTTCTAGCATGTGCTGG + Intergenic
953854760 3:46492775-46492797 TTGCCTCTTCCAGCTTCTGTGGG + Intergenic
954503654 3:51047118-51047140 TTTCTTTTTCTAGCTTCTTGAGG - Intronic
954759381 3:52862969-52862991 TTGCCTCTTTCAGCTTCTGGTGG - Intronic
954924300 3:54218784-54218806 TTGCTTTTTCCAGCTTCTAGAGG + Intronic
954949038 3:54452817-54452839 TTGCCTCTTCTGGCTTCTGGTGG + Intronic
954965823 3:54610003-54610025 TTGCCTCTTCTAGCCTCTGGTGG + Intronic
955413748 3:58673223-58673245 TTGCTTCTTCTAGTATCTAGAGG + Intergenic
955569769 3:60291871-60291893 TTGCCTCTTCGAGCTTCTAGTGG - Intronic
955654400 3:61229336-61229358 TTGCCTCTTCTAGCTTCTGGTGG - Intronic
956010253 3:64823064-64823086 TTGCCTCTTTTAGCTTCTGGTGG + Intergenic
956312107 3:67892713-67892735 TTGCCTCTCCTAGCTTCAGGTGG - Intergenic
956323847 3:68028608-68028630 TTGCTTCTTCCAGATTCTTGTGG + Intronic
956481107 3:69674827-69674849 TTGCCTTTTCCAGCTTCTGGTGG - Intergenic
956536230 3:70280109-70280131 TTGCCTCTTCCAGCTTCTGGGGG + Intergenic
956692039 3:71887547-71887569 TTGCCTCTTCTAGCTGCTGGTGG - Intergenic
956704429 3:71987197-71987219 CTGCTGCTTCCAGCTTCTGGTGG - Intergenic
956862723 3:73340353-73340375 TTGCTTCCTCCAGCTTTTGGGGG + Intergenic
956955431 3:74333410-74333432 TTGCCTCTTCCAGCTTCTGGTGG + Intronic
957032511 3:75258029-75258051 TGGCTTTTTCTAGCTTTTAGAGG + Intergenic
957037158 3:75304407-75304429 TTACTTTTTCTAGCTTTTAGAGG - Intergenic
957058291 3:75461010-75461032 TCGCCTCTTCTGGCTTCTGGTGG + Intergenic
957060271 3:75475794-75475816 TTGCCTCTTCCAGCTTGTAGAGG - Intergenic
957587797 3:82155119-82155141 TTGCTTCTTTTAGCTTCTGGTGG + Intergenic
957682870 3:83460250-83460272 TTGCCTCTTCCAGTTTTTGGTGG - Intergenic
957892442 3:86377691-86377713 TTGCTTTTTCCAGCTTCTAGAGG + Intergenic
957989921 3:87614639-87614661 TTACTTCCTCTAGCTTTTAGGGG + Intergenic
957991525 3:87633362-87633384 TTGCCTCTTTCAGCTTCTGGTGG + Intergenic
958572186 3:95900091-95900113 TTGGTTCTTCCAGCTTCTGGTGG + Intergenic
958612649 3:96447277-96447299 TTGCCTCTTCCAGCTTCTGTTGG + Intergenic
958931640 3:100213884-100213906 TTGCTTTTTTCAGCTTCTGGAGG - Intergenic
959149954 3:102596420-102596442 TTGCCTCTTCCAGCTTCTGGTGG + Intergenic
959231557 3:103660206-103660228 TTGCCTCTTCTAGCTTCGGGTGG - Intergenic
959274203 3:104256874-104256896 TTGCCTCTTTCAGCTTCTGGTGG - Intergenic
959320684 3:104870990-104871012 TTGCTTCCTTTAGCTTCTGGTGG - Intergenic
959480591 3:106867408-106867430 TTGCTTCTCCTAGTTTCTGGTGG + Intergenic
959535656 3:107482275-107482297 CTGCTTCTTCCAGCTTCTGGTGG + Intergenic
959837301 3:110934979-110935001 TTGCTTCTTCTATCTTTTGGTGG + Intergenic
960170971 3:114460552-114460574 TTGCCTTTTCTATCTTTTGGAGG - Intronic
961080927 3:124027195-124027217 TTACTTTTTCTAGCTTTTAGAGG - Intergenic
961205884 3:125081210-125081232 CTGCCTCTTCCAGCTTCTGGTGG - Intergenic
961293118 3:125863617-125863639 TTGCCTCTTCCAGCTTGTAGAGG + Intergenic
961295151 3:125878687-125878709 TTGCCTCTTGTGGCTTCTGGTGG - Intergenic
961299284 3:125911932-125911954 TTGCCTCTCCTGGCTTCTGGTGG + Intergenic
961729987 3:128957949-128957971 TTGCCTCTTCCAGCTTCTGGTGG + Intronic
961890749 3:130128475-130128497 TTGCCTCTTCTGGCTTCTGGTGG + Intergenic
961894066 3:130152793-130152815 TTGCGTCTTCCAGCTTATAGAGG - Intergenic
962021646 3:131508426-131508448 TTGCCTTTTCTAGCTTCTAGAGG - Intergenic
962148029 3:132861733-132861755 TTGCTTTTTCTAGTATGTAGAGG - Intergenic
962636319 3:137335496-137335518 TTGCCTCTTCCAGCTTCTGGTGG - Intergenic
962644147 3:137419622-137419644 TTTCCTCTTCTAGCTTCTGATGG + Intergenic
962908149 3:139823973-139823995 TCGCCTCTTGTAGCTTTTGGTGG + Intergenic
963083607 3:141416834-141416856 TTGCCCCTTCTAGTTTCTGGTGG - Intronic
963950082 3:151190032-151190054 CTGCTTTTTCTAGCTTGAGTGGG - Intronic
964323012 3:155517484-155517506 TTGCCTCTTCCAGCTTATGGTGG + Intronic
964353530 3:155826900-155826922 TTGTTTCGTCTAACTTTTGGAGG + Exonic
964518809 3:157542200-157542222 TAGCCTCTTCCAGCTTCTGGTGG + Intergenic
964542271 3:157792680-157792702 TTGCCTCCTCCAGCTTCTGGTGG + Intergenic
964638888 3:158886968-158886990 TTGCTTCTCATAGCTTGCAGAGG - Intergenic
964792104 3:160462064-160462086 TTGCCTCCTCCAGCTTCTGGTGG + Intronic
964928704 3:161988878-161988900 TTGCATCTTCTAGATATTGGTGG + Intergenic
964998821 3:162925629-162925651 ATGTCTCTTCTAGCTTTTGGTGG + Intergenic
965127036 3:164644087-164644109 TTGCCTTTTCTAGCTTCTAGAGG + Intergenic
965316671 3:167199970-167199992 TTGATTTTTCTAGCTTCTAGTGG + Intergenic
965458707 3:168933893-168933915 ATTCTTTTTCTAGCTTTTGGTGG + Intergenic
965873568 3:173289406-173289428 TTGCTTCTTCCAGCTTCTGCAGG + Intergenic
966278297 3:178201796-178201818 TTGCTTCTTCTAGCTTGTGGTGG + Intergenic
966435982 3:179884445-179884467 TTGCTTTTTCCAGCTTCTAGAGG - Intronic
966476606 3:180355872-180355894 TTGCCTCTTCCAGCTTCTGGTGG + Intergenic
966758829 3:183396908-183396930 TTGTCTCTTCTGGCTTCTGGGGG - Intronic
966992252 3:185244741-185244763 TTGCCTCTTCTAGCTTCTTATGG - Intronic
967122133 3:186391572-186391594 TTGCCCCTTCCAGCTTCTGGTGG - Intergenic
967303218 3:188037267-188037289 CTGCCTCTTCCTGCTTGTGGGGG - Intergenic
967514099 3:190346719-190346741 TGCCTTCTCCTAGCTTGTAGTGG + Intronic
967514755 3:190354014-190354036 TTGCCTCTTCTAGCTTCTGCTGG + Intronic
967518312 3:190398358-190398380 TAGCCTCTTCCAGCTTCTGGTGG + Intronic
967794699 3:193587305-193587327 TTGCTTATTCCATCTTCTGGTGG + Intronic
967811308 3:193763299-193763321 TTGCCTCTTCTAACTTCTAGAGG + Intergenic
967924835 3:194637948-194637970 TTGCCTCTTCCAGCTTCTGGTGG + Intergenic
967968504 3:194982776-194982798 TTGTTTCTTCCAGTTTCTGGTGG - Intergenic
969002134 4:3990890-3990912 TTGCCTCTTCTGGCTTCTGGTGG + Intergenic
969004162 4:4005870-4005892 TTGCCTCTTCCAGCTTGTAGAGG - Intergenic
969072081 4:4547614-4547636 TTGCTTCCTCTGGTTTCTGGTGG - Intergenic
969108691 4:4827962-4827984 TTGTCTCTTCCAGCTTCTGGTGG - Intergenic
969119697 4:4899028-4899050 CTGCTTCTTCTAGCTTTTGGTGG + Intergenic
969138190 4:5048038-5048060 ATGCTTCTTCCAGCATCTGGTGG - Intergenic
969259612 4:6025146-6025168 CTGCTTCTCCTGGATTGTGGGGG - Intergenic
969464338 4:7346111-7346133 TTTCTTTTTCTAGCTTCTTGAGG + Intronic
969609676 4:8219927-8219949 TTGCCTCTTCCAGCTCCTGGTGG + Intronic
969685706 4:8672845-8672867 CTGCCTCTTCCAGCTTCTGGTGG + Intergenic
969748697 4:9094275-9094297 TTGCCTCTTCCAGCTTGTAGAGG + Intergenic
969751869 4:9117620-9117642 TTGCCTCTTCTGGCTTCTGGTGG - Intergenic
969809744 4:9638843-9638865 TTGCCTCTTCCAGCTTATAGAGG + Intergenic
969815979 4:9687782-9687804 TTGCCTCTTCTGGCTTCTGGTGG + Intergenic
969971836 4:11055838-11055860 TTGCCTCTTCTCGCTTAAGGTGG + Intergenic
970017634 4:11530651-11530673 TTGTCTCTTCCAGCTTCTGGTGG + Intergenic
970211357 4:13713424-13713446 TTGCCTCTTCCAGCTTCTGGTGG - Intergenic
970439259 4:16066035-16066057 TTGCCTCTTCTAGCTTCTGATGG - Intronic
970447668 4:16137500-16137522 TTGCCTCTTCTGGCTTCTGGTGG + Intergenic
971152232 4:24045519-24045541 TGGCCTCTTCTAGCTTCTGGTGG + Intergenic
971477192 4:27083555-27083577 TTACCTCTTCCAGCTTCTGGTGG + Intergenic
971479309 4:27100013-27100035 TTGGCTCTTCTAGCTTCTTGTGG + Intergenic
971650440 4:29265015-29265037 TTACTTCTTCCAGCTTCTAGTGG - Intergenic
971822887 4:31581653-31581675 TTGCCTCTTCCAGCTTCTGGTGG + Intergenic
972102725 4:35443141-35443163 TTGCTTCTTCCAGCTTCTAGTGG + Intergenic
972195894 4:36653612-36653634 TTGCCTCTTCCAGCTTCTAGAGG - Intergenic
973025476 4:45264173-45264195 TTTTTTCTTCTAGTTTCTGGTGG - Intergenic
973116584 4:46467673-46467695 TTGCTTTTTCCAGCTTCTAGAGG - Intronic
973127499 4:46605951-46605973 TTGCTTCTTCTAGCTTCTGGTGG - Intergenic
973208615 4:47589147-47589169 TTGCCTCTTCCAGCTTCTGGTGG - Intronic
973611338 4:52638332-52638354 TTGCCTTTTCTAGTTTGTAGAGG - Intronic
973682753 4:53338056-53338078 TTGCCTCTTCTAGATTCTTGGGG - Intronic
973902778 4:55494796-55494818 TTGTTTTTTCCAGCTTGTAGAGG - Intronic
974165496 4:58195989-58196011 TTGCCTCTTCCAGCTTCTGCTGG - Intergenic
974277671 4:59746155-59746177 TTGATTCTTCTAGTTCCTGGAGG - Intergenic
974695646 4:65366951-65366973 TTTTTTCTTCTAGCTTTTAGTGG - Intronic
974770586 4:66406371-66406393 TTGTTTCTTCTAGCTTCTGATGG + Intergenic
974824596 4:67111565-67111587 TTGTCTCTTCCAGCTTCTGGTGG + Intergenic
974853091 4:67427326-67427348 TTGCCTCTTCCAGTTTTTGGTGG + Intergenic
975136819 4:70883238-70883260 TTGCATTTTCTAACTTCTGGAGG - Intergenic
975240861 4:72057421-72057443 TTGCTTCTTCCAGCTTGTGGTGG + Intronic
975251057 4:72178126-72178148 TTGCTTCTTTAAGTTTCTGGTGG - Intergenic
975262122 4:72315507-72315529 TTGCTTCTCCCAGCATCTGGTGG - Intronic
975280639 4:72558322-72558344 CTGCTTTTTCCAGCTTTTGGAGG + Intronic
975302868 4:72811773-72811795 TTGCCTTTTCCAGCTTCTGGAGG - Intergenic
975478929 4:74856362-74856384 TTGCTTCTTCCAGCTTCTGGTGG + Intergenic
975487508 4:74950332-74950354 TTGCTTCTTCTAGCTTCCAGTGG + Intronic
975678063 4:76847423-76847445 TTCCCTCTTCTAGATTTTGGTGG + Intergenic
975885378 4:78958655-78958677 TTGCCTCTTCTAGTTTCTGGTGG - Intergenic
975968469 4:80004517-80004539 TTGCCTCTTCCAGCTTCTAGTGG + Intronic
976132740 4:81902388-81902410 TTGCCTTTTCTAGCTTCTAGTGG + Intronic
976362878 4:84201072-84201094 TTGCCTCTTCCAGCTTCTGATGG + Intergenic
976374835 4:84333859-84333881 TTCCTTCTTTTAACTTGTGTTGG + Intergenic
976392575 4:84520626-84520648 TTGCCTTTTCTAGCTGCTGGAGG + Intergenic
976399965 4:84596412-84596434 TTGCCTTTTCTAGCTTCTAGAGG + Intronic
976648898 4:87414265-87414287 TTGCCTCTTAGAGCTTCTGGTGG - Intergenic
976796441 4:88939243-88939265 TTGCCTCCCCTAGCTTCTGGTGG + Intronic
976834997 4:89361975-89361997 TTGACTCTTCTGGCTTCTGGTGG + Intergenic
977399868 4:96519310-96519332 TTGCTTCTTCTAACTTCTGATGG - Intergenic
977707843 4:100091474-100091496 CTGCCTCTTCCAGCTTCTGGTGG + Intergenic
978199940 4:106014184-106014206 TTACCTCTTCCAGCTTCTGGTGG + Intergenic
978581550 4:110236579-110236601 TTGGTTCCTCCAGCTTCTGGTGG + Intergenic
978623582 4:110659206-110659228 TTGCCCCTTCCAGCTTCTGGTGG - Intergenic
979186606 4:117803399-117803421 TTGCTTTTTCTACCTTTTAGAGG + Intergenic
979504310 4:121478495-121478517 TTGCCTCTTCTACCTTCTGGAGG - Intergenic
979672624 4:123376871-123376893 TTGCTTTCTCTAGCTTCTAGAGG + Intergenic
979871757 4:125832186-125832208 TTGCCTCTTCCAGCTGCTGGTGG + Intergenic
980103852 4:128568051-128568073 TTTCCTCTTCCAGCTTCTGGTGG + Intergenic
980258968 4:130422845-130422867 TTGCTTCTTCCAGGTTCTGTTGG - Intergenic
980413600 4:132456550-132456572 TTGCTCTTTCCAGCTTCTGGTGG + Intergenic
980554971 4:134391916-134391938 TTGCTTTTTCTGGCTTCTGGTGG - Intergenic
980685798 4:136226250-136226272 TTGCCTCTTATAACTTCTGGTGG + Intergenic
980869502 4:138594689-138594711 TTGCATCTTTCAGCTTCTGGGGG + Intergenic
980897888 4:138877133-138877155 TTGCCCCTTCTAGCTCCTGGTGG - Intergenic
980974566 4:139598513-139598535 TTGTCTCTTCCAGCTTCTGGTGG - Intronic
981195047 4:141909513-141909535 TCGCCTCTTCTAGATTCTGGTGG - Intergenic
981417178 4:144506802-144506824 TTGCTTCTTCTAACTTCTGGAGG - Intergenic
981451642 4:144905043-144905065 TTGCCTCTTCTAACTTCTGGTGG - Intergenic
981603517 4:146518798-146518820 TTGAGTCTTCTAGCTTGTGGTGG - Intronic
981604109 4:146523969-146523991 TTGCCTTTTCTAGTTTCTGGTGG + Intergenic
981882230 4:149627959-149627981 TTGCCTTTTCCAGCTTCTGGAGG - Intergenic
981980196 4:150782480-150782502 TTGCTTCTTCCAGCTTCTGGTGG + Intronic
982179780 4:152739204-152739226 TTGTCTCTTCCAGCTTCTGGTGG + Intronic
982219567 4:153112936-153112958 TGGCCTCTTCCAGCTTCTGGTGG + Intergenic
982229805 4:153197914-153197936 TTGCCCCTTCTACCTTGTGAGGG + Intronic
982242002 4:153309214-153309236 TGGCTTCTTCTGGGTTTTGGTGG - Intronic
982403041 4:154989628-154989650 TTGCCTCTTCCAGCTTCTGCTGG + Intergenic
982631803 4:157839471-157839493 TTGCTTTTTCCAGCTTCTAGAGG - Intergenic
982771048 4:159397783-159397805 TTGTTTTTTCCAGCTTCTGGAGG - Intergenic
982895748 4:160922297-160922319 TTGCCTCTTCCAGCCTCTGGTGG + Intergenic
982912334 4:161159781-161159803 ATTTTTTTTCTAGCTTGTGGAGG + Intergenic
982956462 4:161774265-161774287 TTGCTTCTTTCAGCTTCAGGTGG - Intronic
982986833 4:162219955-162219977 TTGCCTCTTCTAGCTTCTGAAGG - Intergenic
983035365 4:162858404-162858426 TTGCTTCTTCCACCTTCTGGTGG + Intergenic
983085502 4:163439156-163439178 TTGCTTCTTCTAAGTTATAGGGG - Intergenic
983454579 4:167946655-167946677 TTGTCTCTTCTAGCTTCTGGTGG + Intergenic
983672193 4:170250908-170250930 TTGTCTCTTCTAGCTTCTAGAGG - Intergenic
983697191 4:170546830-170546852 TTGTCTCTTCTAGTTTCTGGTGG + Intergenic
983871423 4:172828591-172828613 TTGTTTCTTCTAGGTTCTGTTGG - Intronic
984344661 4:178507120-178507142 TTGCTTCTCTTATCTTCTGGTGG + Intergenic
984364035 4:178774964-178774986 TTGCTGCCTCTAACTTCTGGTGG + Intergenic
984883863 4:184432813-184432835 TTGCCTCTTCCAGCTTCTGGTGG - Intronic
984891427 4:184497541-184497563 TTGCCTCGTCCAGCTTCTGGTGG - Intergenic
985040647 4:185888421-185888443 TTGCTTCTTCCAAATTTTGGTGG - Intronic
985192520 4:187391382-187391404 TTTCCTCTTCCAGCTTCTGGTGG + Intergenic
985579038 5:687127-687149 CTGCCTCTTCTAGCTTCTGGTGG - Intronic
985593881 5:779190-779212 CTGCCTCTTCTAGCTTCTGGTGG - Intergenic
985887926 5:2694606-2694628 CTGCCTCTTCCAGCTTCTGGGGG - Intergenic
986002297 5:3639775-3639797 TTGCCTCTTCCAGCCTCTGGTGG + Intergenic
986114214 5:4753593-4753615 TTGCCTCTTCCAGCTTCTTGAGG - Intergenic
986224171 5:5797864-5797886 TTGCCTCTTCTGGCATTTGGTGG - Intergenic
986272258 5:6243602-6243624 GTGCCTCTTCTAACTTTTGGTGG - Intergenic
986459100 5:7951831-7951853 TTGCCTCTTTGAGCTTCTGGTGG - Intergenic
986622588 5:9691292-9691314 TTGCCTCTTCCGGCTTCTGGGGG - Intronic
986649659 5:9950389-9950411 TTGCCTCCTCCAGCTTCTGGTGG - Intergenic
986692046 5:10321100-10321122 TTGCCTCTTCTGGCTTCTGGAGG + Intergenic
986708920 5:10473444-10473466 TTGCTTCCTCCAACTTCTGGTGG - Intergenic
986760079 5:10872175-10872197 TTGCTTTTTCCAGCTTGTCGTGG + Intergenic
987134579 5:14888973-14888995 TTGCTTCTTCCAGCATCTGGTGG + Intergenic
987181587 5:15373566-15373588 TTGCCTCTTCCACCTTCTGGTGG + Intergenic
987295994 5:16551868-16551890 TGGCTTCTTCCAGCTTCTAGAGG + Intronic
987778066 5:22395307-22395329 TTGCCTATTGTAGCTTCTGGTGG - Intronic
988207445 5:28158224-28158246 TTGTATCTTCAAGCTTTTGGTGG + Intergenic
988644600 5:33080463-33080485 TTTCCTCTTCCAGCTTCTGGTGG - Intergenic
988713404 5:33801087-33801109 TTGCCTCTTCCAGCTTCTAGTGG - Intronic
988771485 5:34437434-34437456 TTGCTTCTTCCAGCTTCTGGGGG - Intergenic
988806406 5:34744886-34744908 TTGCCTCTTCTAGCTCCTGGTGG + Intronic
988883872 5:35534019-35534041 TTGCTTTTTCCAGCTTCTGGAGG - Intergenic
989001602 5:36766571-36766593 TTGATTCTTCCAGTTTTTGGTGG + Intergenic
989091133 5:37733150-37733172 ATGCCTCTTCTAGCTTCTAGAGG + Intronic
989116496 5:37958930-37958952 TTGCCTCATCCAGCTTCTGGTGG - Intergenic
989242372 5:39216042-39216064 TGGCCTCTTCCAGCTTCTGGTGG - Intronic
990167516 5:53011012-53011034 TTGTTTCTTCTATCTTCTTGGGG - Intronic
990300785 5:54447388-54447410 TTGCCTCTTCTAGCTTCTAATGG + Intergenic
990317354 5:54595850-54595872 TTGCCTCTTCCAACTTCTGGTGG + Intergenic
990431848 5:55743203-55743225 TTGCTTCTTCTAGCTTCTAGTGG + Intronic
990440693 5:55842093-55842115 CTCCTTCTCCTAGCTTGTTGTGG + Intergenic
990455643 5:55984540-55984562 TTGCCTCTCCTAGCTTCTGGTGG - Intronic
990595288 5:57307014-57307036 TTGCTTCTGCTAGGTGTTGGAGG + Intergenic
990604045 5:57390049-57390071 TTTCTTCTTCAATCTTGTGTTGG + Intergenic
990740488 5:58907710-58907732 TTACCTCTTCCAGCTTCTGGTGG - Intergenic
990837103 5:60034392-60034414 TTTCTTCTTCCAGCTTCTAGAGG + Intronic
991098221 5:62762183-62762205 TTGCCTCTTCCAGCTTCTGGTGG - Intergenic
991132322 5:63136868-63136890 TTGCCTTTTCTAGCTTCTGATGG - Intergenic
991259896 5:64655627-64655649 TTTCTTTTTCCAGCTTCTGGAGG + Intergenic
991386658 5:66098404-66098426 TTGCTTTTTCCAGCTTCTAGAGG - Intergenic
991433230 5:66569567-66569589 TTGCTTTTTCTAAGTTGTGGAGG - Intergenic
991467353 5:66927886-66927908 ATGCCTCTTCTAGCTTCTGGTGG + Intronic
991574605 5:68089950-68089972 TTGCCTCTTTTGGCTTCTGGTGG + Intergenic
991605619 5:68397625-68397647 TTGCCTCTTCCAACTTCTGGTGG - Intergenic
992092459 5:73329659-73329681 TTTCTTTTTCTAGGTTGTTGAGG + Intergenic
992125288 5:73633410-73633432 CTGCTGCTTCTAGCTTGTCTTGG + Intronic
992278170 5:75143070-75143092 GTGCCTCTTCTAGCTTCTGATGG + Intronic
992759969 5:79942889-79942911 CTGCCTCCTCTAGCTTCTGGAGG + Intergenic
992779824 5:80117785-80117807 TTACTTCTTCCAGCTTTGGGTGG + Intronic
992885366 5:81153462-81153484 TTGCTTTTTCCAGCTTCTAGAGG - Intronic
993146703 5:84102924-84102946 GTGATACTTCTAGCTTTTGGGGG - Intronic
993199041 5:84788938-84788960 TTGCCTCTTCTAGGTTCTGGCGG + Intergenic
993778939 5:92041505-92041527 TTGCCTCTTCCAGTTTTTGGCGG + Intergenic
993853336 5:93038466-93038488 TTCCTTCTTCTAGCCTGGTGGGG + Intergenic
994162844 5:96576243-96576265 TTCCTTCTTCTATTTTCTGGAGG + Intronic
994321887 5:98404098-98404120 TTGCCTTCTCTAGCTTCTGGAGG - Intergenic
994797569 5:104324063-104324085 TTGCTTCTTCCAGCATCTGGTGG + Intergenic
995239619 5:109871174-109871196 TTGCTTCATCTAGCGTGTATTGG - Intergenic
995249278 5:109971651-109971673 TTACTTCTTCCAGCTTCTGGTGG + Intergenic
995587138 5:113659850-113659872 TTGCCTCTTCCAGCTTCGGGTGG - Intergenic
995602276 5:113810571-113810593 TTGCCTCTCCCAGCTTATGGTGG - Intergenic
996425383 5:123308019-123308041 TTGCCTCTTCCAGCATCTGGAGG + Intergenic
996560235 5:124820583-124820605 TTGCTTATTCCAGTTTATGGTGG + Intergenic
996600613 5:125258696-125258718 TTGCTTATTCCAGCTTCTGGTGG - Intergenic
996810866 5:127515190-127515212 TTGCCCCTTCTAGCTTCTGGTGG - Intergenic
996946617 5:129078184-129078206 TTGCCTCTTCTGGCTTCTGGTGG - Intergenic
997229383 5:132231602-132231624 TTGCCTCTTCCAGCTCCTGGTGG + Intronic
997254436 5:132417591-132417613 TTGCTTTTTCCAGCTTCTAGAGG + Intronic
997343077 5:133161800-133161822 TTGCCTCTTCCAGCTCCTGGTGG - Intergenic
997429299 5:133826478-133826500 TTGCCTCTTTCAGCTTCTGGTGG + Intergenic
997904851 5:137806410-137806432 TTTCTTCTTCTAACTTCTAGAGG - Intergenic
998065718 5:139156712-139156734 TTGCTGCTTCTAGCTTCTGGTGG - Intronic
998070265 5:139192317-139192339 TTGCTTCTTCAGTCTTGTGATGG - Intronic
998451570 5:142238693-142238715 TTGCCTCTTCTAGCTTCTGGTGG + Intergenic
998486849 5:142510382-142510404 TTGCCTCTTCTAGCTTCTGGTGG + Intergenic
999091531 5:148940527-148940549 TTGCCTCTTCCAGCTTCTGGTGG + Intronic
999378562 5:151104145-151104167 CTGCCTCTCCTAGCTTCTGGTGG - Intronic
999420479 5:151437892-151437914 TTGCTTTTTCCAGCTTCTAGAGG + Intronic
999670567 5:153955853-153955875 TTGCCTCTTCCAGATTCTGGTGG + Intergenic
999828644 5:155298457-155298479 TTGCTTCTTCATGAATGTGGGGG + Intergenic
999830232 5:155311984-155312006 CTGCTTCTTTTTGCTTGTGGAGG + Intergenic
999888993 5:155956670-155956692 TTGGCTCTTTCAGCTTGTGGTGG + Intronic
999893920 5:156008255-156008277 TTCCTCTTTCTAGCTTCTGGTGG + Intronic
999978000 5:156931142-156931164 TTGCTTTTTCTAGCTCCTAGAGG - Intronic
1000348776 5:160336452-160336474 TTGCCTCTTCCAGCTTCTGGTGG - Intronic
1000397933 5:160795793-160795815 TTGACTCTTCTAGCTTCTGGTGG - Intronic
1001013914 5:168123624-168123646 TTGCTTCTTCTATCACCTGGGGG - Intronic
1001250053 5:170140174-170140196 TGGCCTCTTCCAGCTTCTGGTGG + Intergenic
1001432856 5:171676992-171677014 TTACTCCTTCCAGCTTCTGGTGG + Intergenic
1001832961 5:174804987-174805009 TTGCCTCTTCTAGCTTCTGATGG + Intergenic
1002208440 5:177580535-177580557 TTGCTTCTCCCAGCTTCTGGTGG - Intergenic
1002609091 5:180402443-180402465 TTGCCTCTTCTAACTTTTGGTGG + Intergenic
1002872990 6:1184373-1184395 TTGCTTTGACTAGATTGTGGAGG - Intergenic
1002981172 6:2140325-2140347 TTTCTTCTTCTAACTTCTAGTGG - Intronic
1003066877 6:2911267-2911289 CTGTTTCTTCCAGCTTCTGGTGG - Intergenic
1003412045 6:5874152-5874174 ATGCCTCTGCTAGCTTCTGGTGG + Intergenic
1003606189 6:7563358-7563380 TTTCTTCTTCTGGCTTTTTGGGG + Intronic
1003671979 6:8167892-8167914 TTGCTTCTTCCAGCGTCTGGTGG + Intergenic
1003880526 6:10476052-10476074 TTGCCTTTTCCAGCTTCTGGTGG - Intergenic
1003897306 6:10619852-10619874 TTGCCTTTTCTAGCTTCTAGAGG + Intronic
1004279496 6:14268965-14268987 TTGCCTCTTCCAGCTGCTGGTGG + Intergenic
1004289261 6:14351510-14351532 TTGCCTCTTCTAGTGTCTGGTGG - Intergenic
1004311133 6:14546133-14546155 TTTCCTCTTCTAGCTTCTGGTGG + Intergenic
1004323150 6:14648730-14648752 CTGCCTCTTCAAGCTTCTGGTGG + Intergenic
1004323540 6:14652445-14652467 TTGCTTCTTCCAGCTTCTGGAGG - Intergenic
1004563156 6:16770641-16770663 TTGCCTCTTCTAGCTTCTGGTGG - Intergenic
1004690831 6:17990698-17990720 TTCCTCCTCCTAGCTTCTGGTGG - Intergenic
1004697282 6:18045515-18045537 CTGCCTCTTCCAGCTTCTGGTGG - Intergenic
1004750081 6:18553733-18553755 TTGCCTCTTCCACCTTCTGGTGG - Intergenic
1004829362 6:19460980-19461002 TTGCCTCTTCCAGCTTCTGGTGG - Intergenic
1005004549 6:21274611-21274633 TTTCTTCTTCTAGCTATTGCTGG + Intergenic
1005051512 6:21688074-21688096 TTGCCTCTTCTAGCTTGTGGTGG - Intergenic
1005054778 6:21719330-21719352 TTGTGTCTTCCAGCTTCTGGTGG + Intergenic
1005261566 6:24066707-24066729 TTGCCTCTTCCAGCTTCTAGGGG - Intergenic
1005261728 6:24068336-24068358 TGGCCTCTTCTAGCTTCTGGTGG - Intergenic
1006350013 6:33514100-33514122 TTGCCTCTTCCAGTTTCTGGTGG - Intergenic
1006719330 6:36139840-36139862 TGGCTCTTTTTAGCTTGTGGCGG + Exonic
1006943908 6:37771471-37771493 TTGCCTCTTCTAGTTTCTGGTGG + Intergenic
1006984584 6:38168267-38168289 TCGCTTCCTCTGCCTTGTGGAGG - Intergenic
1007039562 6:38709591-38709613 TTGCCTCTTCTAGCTTTTGGTGG + Intergenic
1007052867 6:38850746-38850768 TTGCCTCTTTTGGCTTCTGGTGG + Intronic
1007087955 6:39163652-39163674 TTGCCCCTTCCAGCTTCTGGTGG - Intergenic
1007246237 6:40465182-40465204 TTGCTCTTTCTAGCTTCTAGAGG - Intronic
1007247713 6:40474300-40474322 TTGCCTCTTCCAGCTTCTAGTGG + Intronic
1008201876 6:48600781-48600803 TTGCCTCTTCCAGCATCTGGTGG - Intergenic
1008487089 6:52048086-52048108 CTGCCTCTTCTGGCTTCTGGTGG - Intronic
1008569717 6:52804796-52804818 CTGCGTCTTCTAGCTTCTGGGGG - Intergenic
1008574486 6:52847072-52847094 CTGCATCTTCTAGCTTCTGGGGG - Intronic
1008596900 6:53051471-53051493 TTGTCTCTTCCAGCTTCTGGTGG + Intronic
1008640639 6:53458807-53458829 TTGCTCCTTCTAGTTTCTGGTGG - Intergenic
1008642178 6:53475296-53475318 TTGCTTCTTCTAGTTTCTGGTGG + Intergenic
1008844475 6:55946479-55946501 TTGCTTCTTCTAGCTTCTGGAGG + Intergenic
1009026227 6:58003595-58003617 TTGCCTCTTCCAGCCTGTAGAGG + Intergenic
1009194634 6:60669182-60669204 TTGCTGCTTCCAGCTCCTGGTGG + Intergenic
1009201780 6:60755068-60755090 TTGCCTCTTCCAGCCTGTAGAGG + Intergenic
1009281206 6:61753991-61754013 TTGTTTCTTCCAGCTTCTGGTGG - Intronic
1009474290 6:64069071-64069093 TTGCCTCTTCCAGCTTCTGGTGG - Intronic
1009596153 6:65739279-65739301 TTGCCTCTTTTAGCTTGTAGAGG - Intergenic
1009665701 6:66675422-66675444 TTGCCTCTTCTAGCTTTTGGTGG + Intergenic
1010059664 6:71608000-71608022 TTGCCTCTCCCAGCTTCTGGTGG + Intergenic
1010082600 6:71881657-71881679 TTGCCCCTTCTAGCTTCTGGTGG + Intergenic
1010309474 6:74367388-74367410 TTGCCTTTTCTAGCTTCTAGAGG + Intergenic
1010510178 6:76708744-76708766 TTGCCTCTCCTAGCTTCTGGTGG - Intergenic
1010615903 6:78012015-78012037 TTGCTTCCTCTAACTTCTGGAGG - Intergenic
1010777680 6:79905950-79905972 TTGCCTCTTCCAGCTTCTGGTGG + Intergenic
1010928347 6:81770550-81770572 TTGCCTCTTCCAGTTTCTGGTGG + Intergenic
1011379376 6:86725989-86726011 TTGCCTCCTCTAACTTCTGGTGG + Intergenic
1011529030 6:88299751-88299773 ATGCTTCTCCTAGCATCTGGTGG + Intergenic
1011544738 6:88470715-88470737 TTGTTTCTTCCAGCTTCTGGTGG - Intergenic
1011820462 6:91247313-91247335 TTGCCTCTTCTAGCTTTGGGTGG + Intergenic
1011906036 6:92369323-92369345 TTGCTTCTTCCAGCTTCTGGTGG - Intergenic
1012177271 6:96103574-96103596 TTGCTCCCTCTATCTTCTGGTGG + Intronic
1012209992 6:96508103-96508125 TTGCCTCTTTCAGCTTCTGGGGG + Intergenic
1012872497 6:104688699-104688721 TTGTTTCTTCTAACTTCTAGAGG + Intergenic
1013635335 6:112023957-112023979 TTGCTTCTTCCAGCTTCTGGTGG - Intergenic
1013877384 6:114849368-114849390 TTGCCTCTTCCAGCTTTTTGTGG + Intergenic
1014472896 6:121837739-121837761 TTGCATTTTCTAGATTCTGGTGG - Intergenic
1014691099 6:124564495-124564517 TTGCTCCTGCTGGCTGGTGGGGG - Intronic
1014998768 6:128188768-128188790 TTGAGTCTTCTAACTTCTGGTGG + Intronic
1015212853 6:130717643-130717665 TTGCCTCTTCCAGCTTCTGGTGG - Intergenic
1015219263 6:130785371-130785393 CTGTCTCTTCCAGCTTGTGGTGG - Intergenic
1015282235 6:131446187-131446209 TTGCCTCTTCCAGCTTCTGGTGG + Intergenic
1015498010 6:133901051-133901073 TTGCCTCTTCTGGTTTCTGGTGG - Intergenic
1015792031 6:136973466-136973488 TTGCCTCTTCTAGCTTCTGGTGG + Intergenic
1015796970 6:137022871-137022893 TTGCTTCTTCCAACTCCTGGTGG - Intronic
1016397402 6:143639912-143639934 TTGCTTCCTCCAGCTTCTGGAGG - Intronic
1016615972 6:146048810-146048832 TGCCTTCTCCTAGCTTTTGGTGG - Intronic
1016637917 6:146316165-146316187 TTGCTTTTTCTGGCTTTTAGAGG + Intronic
1016824892 6:148378957-148378979 TTGGTTTTTCTAGCTGGTGAGGG + Intronic
1016908723 6:149176464-149176486 TTGCCTTTTCCAGCTTGTGGAGG + Intergenic
1017916786 6:158837295-158837317 TTGCCTCCTCCAGCTTCTGGTGG + Intergenic
1018350769 6:162956607-162956629 TCGCCTCTTCCAGCTTCTGGTGG + Intronic
1018363417 6:163095589-163095611 CTGCTGCTTCTAGCTTCCGGAGG + Intronic
1018430503 6:163718017-163718039 TTGTCTCTTCCAGCTTCTGGTGG + Intergenic
1018993665 6:168693990-168694012 TCCCTTCTTCTGGCTTGTGTTGG + Intergenic
1019106578 6:169672683-169672705 TTACCTCTTCTGGCATGTGGTGG - Intronic
1020181525 7:5926374-5926396 TTTCTTCTTCTTGCTGGTGATGG + Exonic
1020301408 7:6798515-6798537 TTTCTTCTTCTTGCTGGTGATGG - Exonic
1020324297 7:6962366-6962388 TTGCCTCTTCCAGCTTGTAGAGG - Intergenic
1020457597 7:8391659-8391681 TTGCTTTTTCCAGCTTCTAGAGG - Intergenic
1020627608 7:10601258-10601280 TTGACTCTTCTAGCTTCTGGTGG - Intergenic
1020791850 7:12636968-12636990 TTGCTTTTTCTGGCTTCTAGAGG - Intronic
1020975758 7:15004017-15004039 TTGCCTTTTCTAGCTTCTAGAGG + Intergenic
1020999478 7:15310855-15310877 TTGCTTTTTCCAGCTTCTAGAGG + Intronic
1021118577 7:16771629-16771651 TTGCTTCGTCTAGTTTCTGAGGG - Intronic
1021375121 7:19897498-19897520 GTTCTTCTTCTAGTTTGTTGAGG - Intergenic
1021763539 7:23924665-23924687 TTGCCTCTTTCAGCTTGTGATGG - Intergenic
1021979622 7:26041501-26041523 TTGTCTCTTCTGGCTTCTGGTGG - Intergenic
1022409110 7:30122772-30122794 CTGCTTCTCCTGGCATGTGGAGG - Intronic
1022689837 7:32637925-32637947 TTGCCTTTTCTAGCTTCTAGAGG - Intergenic
1022878605 7:34562973-34562995 TTTCCTCTTTCAGCTTGTGGGGG - Intergenic
1023094510 7:36646718-36646740 TTGCCTCTTCTAGTTTTTAGTGG + Intronic
1023173983 7:37417952-37417974 TTGCCCCTTCCAGCTTCTGGTGG - Intronic
1023180061 7:37473536-37473558 CTGCTTCTTCTATCCTGTTGAGG + Intergenic
1023381513 7:39612915-39612937 TTGCTTCTTCCAGCTTCTAGAGG - Intergenic
1023727779 7:43162366-43162388 TTTCCTCTCCTAGCTTCTGGGGG + Intronic
1024315370 7:48010908-48010930 TTGCCTTTTCTAACTTCTGGTGG + Intronic
1024377144 7:48652817-48652839 TTGCCTCTTCTTGCTTCTGATGG + Intergenic
1024700731 7:51901592-51901614 CTGCTTCTTCTGGCTTCTGGTGG + Intergenic
1024728798 7:52231662-52231684 TTGCTTCTTCCAGCTTCTGGTGG - Intergenic
1026254102 7:68695942-68695964 TTGCTTTTTTTAGCTTCTGGAGG - Intergenic
1026564044 7:71474998-71475020 TTGCCTCTTCCAGCATCTGGTGG - Intronic
1026842065 7:73675002-73675024 TTGCTGCTTCTAGATTCAGGGGG + Intergenic
1026975072 7:74492788-74492810 TGGCCTCTTCTAGCTCCTGGGGG + Intronic
1027888431 7:83938806-83938828 TTGATTCTTCTGGTTTCTGGTGG + Intergenic
1027894184 7:84019812-84019834 TTGCTTTTTCTGGCTTCTTGTGG + Intronic
1027981382 7:85227420-85227442 TTGCTTTTTCTAACATGTGAGGG + Intergenic
1028104910 7:86865778-86865800 ATGCCTCTTCTAGCTTCTGGTGG + Intergenic
1028162412 7:87500432-87500454 TTGTCTCTTCCAGCTTTTGGTGG + Intergenic
1028291080 7:89065715-89065737 TTGCTTTTTCCAGCTTCTAGAGG + Intronic
1028294948 7:89117111-89117133 TTGCCTCTTCCAGCTTGTAATGG - Intronic
1028358396 7:89937626-89937648 TTGCTTCTTTCAGCTTCTGGTGG - Intergenic
1028366714 7:90040681-90040703 TTGCTTCTTCCAGCTTCTGGTGG + Intergenic
1028455382 7:91032634-91032656 TTGCCTCCTCCAGCTTCTGGTGG - Intronic
1028843650 7:95455332-95455354 TTGCCTTTTCTAGCTTCTAGAGG + Intergenic
1029174861 7:98657571-98657593 TTGCCTCTTCCAGCTTCTGGTGG - Intergenic
1029916851 7:104218945-104218967 GTGCCTCTCCTAGCTTCTGGTGG - Intergenic
1030265913 7:107621728-107621750 TTGCCTCCTCCAGCTTCTGGTGG - Exonic
1030661847 7:112228076-112228098 TTTCCTCTTCCAGCTTCTGGTGG + Intronic
1030675320 7:112379036-112379058 TTGCCTCTTCCAGCTTCTGGTGG + Intergenic
1030989396 7:116281859-116281881 TTGTCTCTTCTAGTTTCTGGAGG + Intergenic
1030991849 7:116310428-116310450 TTGCTTCTTTCAGCTTCTAGTGG + Intronic
1031140009 7:117932168-117932190 TTGCCTCTTCCAGCTCCTGGTGG + Intergenic
1031206994 7:118772657-118772679 TTGCCTCTTCTAGCTTCTAGTGG - Intergenic
1031367903 7:120925582-120925604 TTGCCTCTTCTGGCTTCTGGTGG - Intergenic
1031587250 7:123547086-123547108 TTGCCTCTTTCAGCTTCTGGTGG - Intronic
1031684039 7:124709994-124710016 TTGCTTCTTCTAAGTAGAGGAGG + Intergenic
1031811650 7:126377076-126377098 TTACCTCTTCTAACTTCTGGTGG + Intergenic
1031819204 7:126477927-126477949 TTCCCTCTTCTAGCTTCTGATGG + Intronic
1032158633 7:129492273-129492295 CTGCCTCTTCCAGCTTCTGGGGG + Intergenic
1032294208 7:130621160-130621182 TTGCCTTTTCTAGCTTCTGGAGG - Intronic
1032364600 7:131287394-131287416 TTGCTTCTTCCAGCGTCTGGGGG + Intronic
1032867173 7:135937784-135937806 TTGCTTCAAGTAGCTTGAGGAGG - Intronic
1033189653 7:139265784-139265806 TTGCCTCTTCCAGCTTCTGGTGG - Intronic
1033400300 7:141016526-141016548 TTGACTCTTCCAGCTTCTGGTGG + Intergenic
1033936303 7:146589846-146589868 CTGCTTCCTCTATCATGTGGAGG - Intronic
1034017184 7:147599633-147599655 TTGCCTCTTCCAGCTTCTGGTGG + Intronic
1034107839 7:148506060-148506082 TTGCCTCTTCTGGCTTCTGGTGG + Intergenic
1034229090 7:149506395-149506417 TTGCCTTTTCCAGCTTCTGGTGG + Intergenic
1034230457 7:149522465-149522487 TTGCTTCTTTTAGCTTCTGGTGG + Intergenic
1034254817 7:149719111-149719133 TTGCCTCTTGTGGCTTCTGGTGG + Intronic
1034979019 7:155464085-155464107 TTCCTTCTTCTAGATCCTGGAGG - Exonic
1034987258 7:155523980-155524002 TGGCTTTTTCTAGCTTCTGGTGG - Intronic
1035005836 7:155659863-155659885 TTGCCTCTTCCAGCTTTTGTTGG + Intronic
1036371769 8:8168598-8168620 TTGCGTCTTCCAGCTTGTAGAGG + Intergenic
1036375076 8:8193050-8193072 TTGCCTCTTCTGGCTTCTGGTGG - Intergenic
1036854464 8:12230098-12230120 TTGCCTCTTCTGGCTTCTGGTGG + Intergenic
1036875825 8:12472598-12472620 TTGCCTCTTCTGGCTTCTGGTGG + Intergenic
1036879132 8:12497046-12497068 TTGCGTCTTCCAGCTTGTAGAGG - Intergenic
1036943202 8:13070657-13070679 TTGCCTCTTGTAGCTTCTGGTGG + Intergenic
1037241840 8:16786204-16786226 TTGCCCCTTCTGGCTTCTGGTGG - Intergenic
1037509388 8:19566297-19566319 TTGTTTCTTTTAGCTCCTGGTGG - Intronic
1037597154 8:20363804-20363826 TTGCCTCTTCCAGCTTCTGGTGG - Intergenic
1037758465 8:21726553-21726575 TTGCCTCTTCCGGCTTCTGGTGG + Intronic
1038043776 8:23749103-23749125 TTGCCTCTTCCAGCTTCTAGTGG - Intergenic
1038143383 8:24870806-24870828 TTGCCTCTCCCAGCTTCTGGTGG + Intergenic
1038182323 8:25240910-25240932 TTGCTTCTTCCAGCTTCTGGTGG + Intronic
1038400930 8:27284068-27284090 TTGCTTCCTCTTGCTTGTGGGGG - Intergenic
1038488376 8:27952195-27952217 TTACCTCTTCCAGCTTCTGGGGG - Intronic
1038666657 8:29543388-29543410 TTCCCTCTTCCAGCTTCTGGTGG - Intergenic
1038701840 8:29856217-29856239 TTGCCTCTTCCAGCTTCTGGTGG - Intergenic
1038704134 8:29878349-29878371 TTGCCTCTTCCAGCTTCTGGGGG + Intergenic
1038873435 8:31521082-31521104 TTTCTTCTTTTAGCTTGTAAAGG + Intergenic
1039066558 8:33613570-33613592 TTGCCTTTTCTGGCTTCTGGAGG + Intergenic
1039134566 8:34306245-34306267 TTGCTTGTTTTAGTTTCTGGAGG + Intergenic
1039220166 8:35321467-35321489 TTCCTTCTGCTGCCTTGTGGAGG + Intronic
1039373387 8:37009648-37009670 TTGCCTCTTCCAACTTCTGGTGG - Intergenic
1039595991 8:38790116-38790138 TTGCCTCTTCTAGCCTCTGCTGG + Intronic
1039971188 8:42323019-42323041 TTGCTTCTTCCAGCTCCTGGTGG + Intronic
1040011164 8:42662183-42662205 TTGCCTCTTCCAGCTTCTGGTGG + Intergenic
1040636060 8:49274461-49274483 TTGCTTCTTCTAGTTCCTGGTGG + Intergenic
1040804792 8:51382262-51382284 TTGCTTTTCCTAGTTTCTGGTGG - Intronic
1040891126 8:52317393-52317415 TTGTTTCTTCCAGCTTCTGGTGG - Intronic
1041335573 8:56778925-56778947 TCGCTTCTTCCAGCTTCTGGTGG + Intergenic
1041676272 8:60543300-60543322 TTACCTCTTCCAGCTTGTGGTGG + Intronic
1041742855 8:61175708-61175730 TCACTTCTCCTAGCTTCTGGTGG - Intronic
1041993580 8:64025757-64025779 TTGCCTCTTCCAGCTTGTACAGG - Intergenic
1042028022 8:64444506-64444528 TTGCTTCTTCCAGCTTCTGGTGG + Intergenic
1042101612 8:65280719-65280741 TTGCCTCCTCTAGCTTCTGGAGG + Intergenic
1042109168 8:65361073-65361095 TTGCCTCTTCCAGCTTCTGGAGG + Intergenic
1042295747 8:67215666-67215688 TAGCTTCGTCCAGCTTCTGGCGG - Intronic
1042325600 8:67524448-67524470 TAGCTGTTTCTAGCTTCTGGTGG + Intronic
1042627984 8:70780572-70780594 TTGCCTCTTCAAGCTTCTAGGGG - Intronic
1042689538 8:71482923-71482945 TTCCTTCTTCTTCCTGGTGGTGG + Intronic
1042867539 8:73368941-73368963 TTGCTTCTTCCAGCTTCTGGTGG - Intergenic
1043102432 8:76062418-76062440 TTTCTTCTTCTAGCTCATTGAGG - Intergenic
1043186528 8:77158657-77158679 CTGCCTCTTCCAGCTTCTGGTGG - Intergenic
1043187997 8:77179531-77179553 TTGCTTCTTCCAGCATTTGGTGG + Intergenic
1043494053 8:80780743-80780765 TTGCCTTTTTCAGCTTGTGGTGG - Intronic
1043565624 8:81544351-81544373 TTGCCTTTTCCAGCTTCTGGTGG + Intergenic
1043587043 8:81781567-81781589 TGGCCTTTTCCAGCTTGTGGAGG + Intergenic
1043680295 8:83016348-83016370 TTTCCTCTTCTAGCTTCTAGGGG + Intergenic
1043735655 8:83739851-83739873 TTTCTTCTTCCAGTTTCTGGTGG + Intergenic
1043922227 8:85996593-85996615 TTGCCTCTTCCAGCTTCTGGTGG - Intronic
1043993435 8:86783750-86783772 ATGCCTCTCCTAGCTTCTGGTGG + Intergenic
1044208339 8:89519088-89519110 TTGCCTCTTCAAGATTCTGGTGG + Intergenic
1044304395 8:90620876-90620898 TGGCTTCTCCTACTTTGTGGTGG + Intergenic
1044735853 8:95277143-95277165 ATGCTGCTTCCAGCTTCTGGTGG + Intergenic
1044938658 8:97318191-97318213 TTGCCTCTTCCACCTTCTGGTGG + Intergenic
1044942713 8:97359865-97359887 TTGCCTCTTCCAGCTCCTGGTGG - Intergenic
1045312404 8:101014512-101014534 TTGCCTCTTCTGGCTTCTGGGGG - Intergenic
1045315469 8:101040252-101040274 TTGCCCCTTCCAGCTTCTGGTGG + Intergenic
1045468512 8:102490487-102490509 TTGCCTCTTCCAGCTTCTGGTGG - Intergenic
1045843468 8:106606174-106606196 TTGCCTTTTCTAGCTTCTAGAGG + Intronic
1046010422 8:108539685-108539707 TTGCTTCTTTCAGCTTTTGGTGG - Intergenic
1046069993 8:109239284-109239306 TTGCTTCTTCCAGCTTCTGGTGG + Intergenic
1046160480 8:110356632-110356654 TAGTTTCTTCTAGCTTCTAGTGG + Intergenic
1046177188 8:110593170-110593192 TTGCCTCTTCTACCATGTGAGGG - Intergenic
1046189171 8:110766939-110766961 ATGCTTCTTCTAGCTTCAGCTGG - Intergenic
1046374053 8:113352368-113352390 TTGCTTCTTCCAGCTTCTGATGG - Intronic
1046622333 8:116541537-116541559 TTTCCTCTTTTAGCTTCTGGTGG + Intergenic
1046688318 8:117252743-117252765 TTGACTCTTCCAGCTTCTGGTGG + Intergenic
1046886683 8:119375282-119375304 TTGCTTCTTCCAGCTTCCAGAGG - Intergenic
1047003620 8:120597191-120597213 TTGCATCTTCCAGCTTCTGATGG - Intronic
1047232181 8:123007083-123007105 TTGCCTCTTCCAGCTTCCGGTGG + Intergenic
1047336654 8:123942568-123942590 TTGGCTCTTCCAGCTTCTGGTGG + Intronic
1047509218 8:125503569-125503591 TTGCTTTTTCCAGCTTCTAGAGG - Intergenic
1047541580 8:125771802-125771824 TTGCCTCTTCTAGTTTCTGGTGG - Intergenic
1047600302 8:126419394-126419416 TTTCCTCTTCTAGCTTCTGGTGG - Intergenic
1047717766 8:127611360-127611382 TTGCCTCTTCTAGCTTCTGAGGG - Intergenic
1047718088 8:127614198-127614220 TTGGGTCTTCCAGCTTCTGGTGG - Intergenic
1047763140 8:127968901-127968923 TTGCCTCTCCTGGCTTCTGGTGG - Intergenic
1047780895 8:128110231-128110253 TTGCCTCTTCCAGCTTCTGGAGG - Intergenic
1048018053 8:130514867-130514889 TTGCCCCTTCAAGCTTCTGGTGG + Intergenic
1048136392 8:131750440-131750462 TTCCTTCTTCTATCTTTTGAAGG - Intergenic
1048300173 8:133245595-133245617 CTGCCTCTTCCAGCTTCTGGTGG - Intronic
1048324694 8:133429949-133429971 TTGCTCCTTCCAGCTTCTGGGGG + Intergenic
1048408207 8:134144148-134144170 TTGCTTCTTCTAGTAAGAGGGGG - Intergenic
1049073708 8:140376997-140377019 GTCCTTCCTCTAGCATGTGGTGG - Intronic
1049154826 8:141060053-141060075 TTGCCTCTTCCAGCTTCTGGTGG + Intergenic
1049271097 8:141696715-141696737 TTGCTTCCTAGAGTTTGTGGGGG - Intergenic
1049321439 8:141999001-141999023 CTGCCTCTTCCAGCTTCTGGTGG + Intergenic
1049416010 8:142495577-142495599 TTGCCTCTTCCAGCTTCTGGTGG + Intronic
1050073197 9:1838089-1838111 TTGCCTCTTCTAGCTTCTGCTGG + Intergenic
1050260021 9:3831223-3831245 TTTCTTCTTCTGGCTTGACGTGG - Intronic
1050296480 9:4210355-4210377 TTGCCTTTTCTATTTTGTGGTGG + Intronic
1051019792 9:12529368-12529390 TTGCCTCTTTTAGCATCTGGTGG - Intergenic
1051301738 9:15658722-15658744 TTGCCTTTTCTAACTTCTGGAGG - Intronic
1051400520 9:16677110-16677132 TTACTTTTACTAGCTTGTGGTGG - Intronic
1051588173 9:18748932-18748954 TTGCTTCCTCTACTTTCTGGTGG + Intronic
1051724942 9:20079172-20079194 TTGCCTCTTCCAGCTTCTGGTGG - Intergenic
1051763724 9:20499039-20499061 TTGACTCTCCTAGCTTCTGGAGG + Intronic
1051873766 9:21769015-21769037 TTGCCTTTTCCAGCTTCTGGAGG - Intergenic
1051906600 9:22102532-22102554 TTGCCTCTTCCACCTTCTGGTGG + Intergenic
1052032923 9:23648888-23648910 TTCCCTCTTCCAGCTTCTGGTGG - Intergenic
1052083535 9:24236427-24236449 TCGCTTCTTCTAGCATGGGCAGG + Intergenic
1052262068 9:26528537-26528559 TTGCCTTTTCCAGCTTCTGGTGG - Intergenic
1052355953 9:27504886-27504908 TTGCCTTTTCTAGCTTCTGGAGG + Intronic
1052364462 9:27596393-27596415 TTGCCTCTTCCAGCTTCTGGTGG + Intergenic
1052442999 9:28521933-28521955 TTGCTTCTTCTAGCTTGTGGTGG - Intronic
1052586714 9:30438717-30438739 TTGTTTCTTCTTGTTTTTGGTGG - Intergenic
1052668759 9:31528397-31528419 TTGCCTCTTCTAGCTCCTGATGG + Intergenic
1052826764 9:33182140-33182162 TTGCCTCTTCTAGCTTCTGGTGG + Intergenic
1053138811 9:35669075-35669097 TTGCCTCTTCTAGCTTCTGGCGG - Intronic
1053218021 9:36288919-36288941 TTGCCTCTTCCAGTTTCTGGTGG + Intronic
1054796692 9:69308820-69308842 TTGCCTCTTCCAGCTTCTGGTGG - Intergenic
1054916784 9:70501718-70501740 TTGCTCCTTTTACCATGTGGGGG + Intergenic
1055011330 9:71569283-71569305 TTGCTTCTTCTAGTTTCTGGTGG - Intergenic
1055078338 9:72240776-72240798 TTGCTTCTCCCAGCTTCTGGTGG - Intronic
1055266707 9:74500842-74500864 TTGCTTACTCTAGCCTGGGGCGG + Intronic
1055400981 9:75923808-75923830 TTGCTTTTTCCAGCTTCTAGAGG + Intronic
1055549304 9:77415961-77415983 TTGCTTCTTGTAGCTTTGTGAGG - Exonic
1055768068 9:79686659-79686681 TTGCCTCTTCCAGCTTCTGGTGG - Intronic
1055991496 9:82111102-82111124 TTGCCTCTTCCAGCTTCTGATGG - Intergenic
1056052498 9:82784081-82784103 TTGTGTCTTCGAGCTTCTGGTGG + Intergenic
1056614900 9:88156286-88156308 TTTCTTTTTCTACCTTGTTGAGG + Intergenic
1056819193 9:89825137-89825159 TTTCTTCTTCTTGGTGGTGGTGG - Intergenic
1056996171 9:91461577-91461599 TTGCCTCTTCCAGCTTCTGATGG + Intergenic
1057063159 9:92023805-92023827 TTGCCTCCTCTACCTTCTGGTGG + Intergenic
1057086247 9:92213553-92213575 ATACTTCTTCTAGCTTATGGTGG - Intronic
1057158604 9:92868024-92868046 TTGATTTTTCTAGCTTCTAGAGG + Intronic
1057283651 9:93730103-93730125 ATGCCTCTTCCAGCTTCTGGTGG - Intergenic
1057415462 9:94858514-94858536 TTACCTCTTCCAGCTTCTGGTGG + Intronic
1057540200 9:95960591-95960613 TTGACTCTTCCAGCTTGCGGTGG - Intronic
1057738303 9:97688235-97688257 TTGCCTTTTCTAGCTTCTAGAGG + Intronic
1057742064 9:97720620-97720642 TTGCCTCTTCCAGCTTCTGATGG - Intergenic
1058187667 9:101874492-101874514 TTGCCTCTTCTGGCTTCTGGTGG + Intergenic
1058193311 9:101944589-101944611 GTGCTTCTTCTTGCTTGTGTGGG + Intergenic
1058653986 9:107203177-107203199 TTGCCTCTTCCAGCTTCTGGTGG - Intergenic
1058820181 9:108722526-108722548 TTGCCTCTTCCAGCTCCTGGAGG - Intergenic
1058829797 9:108806160-108806182 TTGCCTCTCCCAGCTTCTGGTGG + Intergenic
1058964194 9:110021285-110021307 TTGCCTCTTCTAGCTACTGGTGG - Intronic
1059013969 9:110493894-110493916 TTGCCTCTTCTAGCTTTTAGAGG + Intronic
1059108518 9:111532506-111532528 TTGCCTCTTCCTGCTTCTGGTGG - Intronic
1059238193 9:112780073-112780095 GTGCTGCTTCTACCTTTTGGAGG + Intronic
1059296027 9:113271540-113271562 TTGGCTCTTCTAGCTTCTGGTGG - Intronic
1059466109 9:114469860-114469882 TTGCCTCTTCCAGCTTCTAGGGG + Intronic
1059689754 9:116673692-116673714 TTGCCTCTTCCAACTTCTGGTGG - Intronic
1059722120 9:116969998-116970020 TTGCCTCTTTCAGCTTCTGGCGG + Intronic
1059749018 9:117230323-117230345 TTGCCTCTTCTCACTTCTGGTGG + Intronic
1059984148 9:119805639-119805661 TTCCTTCTTCCAGCTGCTGGTGG - Intergenic
1060098379 9:120814254-120814276 TTGTTTCTTGTAGCTTCTGCTGG + Intergenic
1060558677 9:124524664-124524686 TTGCTTCTCTTAGCTTGTGAAGG - Intronic
1061647349 9:132015559-132015581 TTGCTTTGTCTTGCTTGGGGTGG - Intronic
1061755770 9:132811470-132811492 TTGCCTTTTCCAGCTTCTGGGGG - Intronic
1062026575 9:134343376-134343398 TTTCTTCTTCTGGGTTCTGGGGG + Intronic
1185659148 X:1713073-1713095 TTGCTTGTTCTCTTTTGTGGGGG - Intergenic
1185813601 X:3132949-3132971 CTGCCTCTTCCAGCTTCTGGGGG + Intergenic
1185825175 X:3242803-3242825 TTGCTTTTTCCAGCTTCTAGAGG - Intergenic
1186501489 X:10054525-10054547 TTGCTTCTCCAAGCTTTTGGTGG - Intronic
1186532586 X:10312243-10312265 TTGCCTTTTCCAGCTTCTGGAGG + Intergenic
1186621905 X:11250572-11250594 TTGACTTTTCTAGCTTGTAGAGG + Intronic
1187019336 X:15363846-15363868 TTGCTTCATCCAGCTTCTGATGG - Intronic
1187034163 X:15520031-15520053 TTGCCTCTTCCAGCTTCTGGTGG - Intronic
1187088946 X:16073558-16073580 TTGTCTCTTCCAGCTTCTGGTGG - Intergenic
1187091511 X:16101801-16101823 TTGCCTCTTCCAGCTTCTGGTGG + Intergenic
1187093084 X:16117928-16117950 TTGCTTCTTCCAGCTGCTGGTGG - Intergenic
1187146813 X:16644633-16644655 TTGCTTTTTCCAGCTTCTAGAGG - Intronic
1187336311 X:18385151-18385173 TTGCCTTTTCCAGCTTCTGGTGG + Intergenic
1187448315 X:19376300-19376322 TTGCCTCTTCTAGCTTCTCGTGG + Intronic
1187494422 X:19782269-19782291 TTGCCTCTCCCAGCTTCTGGTGG - Intronic
1187563496 X:20425093-20425115 TTGCCTCTTCCAGCTTCTGGTGG + Intergenic
1187913075 X:24128511-24128533 TTGCCTTTTCTAGCTTCTGGAGG + Intergenic
1188025974 X:25209785-25209807 TTGCTTCTTCCAGGTTCTGGTGG - Intergenic
1188029921 X:25252897-25252919 TTGCTTCTTCTATCATCTGGTGG - Intergenic
1188148645 X:26645432-26645454 TTGCTTTTTCCAGCTTCTTGAGG - Intergenic
1188274939 X:28188685-28188707 TTGCCTCTTACAGCTTCTGGTGG + Intergenic
1188325861 X:28800113-28800135 TTGCCTCTTCCACCTTCTGGTGG + Intronic
1188865991 X:35313481-35313503 TTGTTTCTTTTAGCTTCTTGTGG + Intergenic
1188981694 X:36732729-36732751 TTGCCTCTTATAGCTTCTGGTGG - Intergenic
1189294223 X:39907585-39907607 TTGCCTCTTCTGGCTTCTGGTGG - Intergenic
1189380201 X:40497284-40497306 TTGCCTCTTCCGGCTTCTGGGGG - Intergenic
1189545230 X:42035852-42035874 ATCTTTCTTCTAGCTTCTGGTGG + Intergenic
1189576557 X:42359747-42359769 TTGCCTCTTCCAACTTCTGGTGG + Intergenic
1189577401 X:42369041-42369063 TTGCTTCTTAAAGCGTCTGGTGG - Intergenic
1189605966 X:42678327-42678349 TTTCCTCTTCTAGCTTCTGGTGG + Intergenic
1189631192 X:42955171-42955193 TTGCTTTTTCCAGCTTCTAGAGG - Intergenic
1189770672 X:44423246-44423268 CTGCCTCTTCCAGCTTTTGGTGG + Intergenic
1189869404 X:45366773-45366795 TTGCCTCTTCCAGCTTTTGGTGG - Intergenic
1189957828 X:46294210-46294232 TTGCCTCTTCCAGCTTCTGGTGG - Intergenic
1190033399 X:46996589-46996611 TTGCCTCTTCCAGCTTTTGGTGG + Intronic
1191023760 X:55891217-55891239 TTGCCTCTTTTAGATTCTGGTGG + Intergenic
1191029470 X:55952470-55952492 TTGCCTCTTCTAGCTTCCAGAGG + Intergenic
1191781314 X:64870439-64870461 TTGAATATTCTAGCTTCTGGTGG + Intergenic
1191958176 X:66669057-66669079 TTATCTCTTCTAGCTTCTGGTGG - Intergenic
1192269354 X:69564326-69564348 TTGCCTCTTCCAGCTTTGGGTGG + Intergenic
1192456382 X:71279592-71279614 TTGTCTCTTCTGGCTTCTGGTGG - Intergenic
1193169942 X:78324032-78324054 GTCCTTCTTCTAGATTGGGGTGG - Intronic
1193380696 X:80813049-80813071 TTGCTTCTTCCAGCTTCTGGTGG + Intergenic
1193892739 X:87070794-87070816 TTGCTTTTTCCAGCTTCTAGAGG + Intergenic
1194408378 X:93526718-93526740 TTGCCCCTTCTAGCTTCTGGTGG - Intergenic
1195381836 X:104278391-104278413 TTGCCTCTTCCAGTTTCTGGTGG + Intergenic
1195588205 X:106591330-106591352 TTGCCTCTTCTGGCTTCTAGTGG + Intergenic
1195715086 X:107810785-107810807 TTACCTCTTCCAGTTTGTGGGGG + Intergenic
1196078698 X:111607117-111607139 TTGCCTCTTCTAGTGTCTGGTGG + Intergenic
1196120502 X:112045345-112045367 TTGCCTTTTCCAGCTTCTGGTGG - Intronic
1196296718 X:114006108-114006130 TTGCGTCTTCCAGCTTCTGGTGG - Intergenic
1196391076 X:115207983-115208005 TTGCTTCTTCCAGCTTCTGATGG - Intronic
1196717057 X:118822390-118822412 TTGCCTCTTCCAGTTTCTGGTGG + Intergenic
1197033418 X:121846658-121846680 TTGCCTCATCTAGCTTCTGGTGG - Intergenic
1197638396 X:128941941-128941963 CTATTCCTTCTAGCTTGTGGAGG + Intergenic
1197657775 X:129136178-129136200 TTGCCTTTTCCAGCTTCTGGTGG + Intergenic
1198235784 X:134734789-134734811 TTGATTCATCTGGCATGTGGGGG + Intronic
1198453483 X:136792068-136792090 TTGCTTCTTCCAGCTTCTGGTGG + Intergenic
1198588809 X:138153235-138153257 TTGATTCTTCCAGCCTTTGGTGG - Intergenic
1198591628 X:138189506-138189528 TTGCCTCTTTAAGCTTTTGGTGG + Intergenic
1198658267 X:138938365-138938387 GTCCTTCTTCCAGCTTTTGGGGG + Intronic
1198678258 X:139153916-139153938 TTGCCTCTTCTAGCTTCTGCTGG - Intronic
1198709545 X:139486247-139486269 TTGTCTCTTCTGGCTTCTGGTGG + Intergenic
1198729868 X:139717573-139717595 TTGCTTCTGCCAGTTTCTGGTGG - Intergenic
1198868793 X:141154337-141154359 TTGCTCCTCCTTGCTAGTGGAGG - Intergenic
1199040521 X:143110594-143110616 TTGCTTTCTCTATCTTGTGGAGG - Intergenic
1199211803 X:145220942-145220964 TTGCCTCTTCCAGCTTCTGGTGG + Intergenic
1199474162 X:148227726-148227748 TTGCCCCTTCCAGCTTCTGGTGG + Intergenic
1199511364 X:148626641-148626663 TTGCTTCTTCCAGCTTCTCATGG + Intronic
1199666005 X:150097081-150097103 TTGCTTTTTCTGGCTTCTAGAGG + Intergenic
1199680967 X:150224419-150224441 TTGCTTCTTCCAGCTTCTGGTGG + Intergenic
1199691074 X:150309420-150309442 TTGCCTTTTCCAGCTTCTGGAGG + Intergenic
1199692438 X:150318810-150318832 TTGGTTTTTCCAGCTTCTGGTGG - Intergenic
1199734773 X:150675575-150675597 TTGCTTTTTCCAGCTTCTCGTGG + Intergenic
1199740754 X:150734076-150734098 TTGCCTCTTCCAGCATGGGGTGG + Intronic
1199768250 X:150956310-150956332 TTGCTTCTTCCAGCTTCTGGTGG + Intergenic
1199925041 X:152453438-152453460 TTGTCTCTTCCAGCTTCTGGTGG + Intergenic
1200050973 X:153431569-153431591 CTGCCTCTTCCAGCTTCTGGTGG - Intergenic
1200088601 X:153624019-153624041 CTGCTTCTTCCAGCTCCTGGGGG - Intergenic
1200169736 X:154063926-154063948 TTGCCTCTTCCAGCTTTTGGTGG - Intronic
1200183648 X:154167558-154167580 TTGCCTCTTCCAGTTTCTGGTGG - Intergenic
1200189302 X:154204686-154204708 TTGCCTCTTCCAGTTTCTGGTGG - Intergenic
1200195057 X:154242495-154242517 TTGCCTCTTCCAGTTTCTGGTGG - Intergenic
1200200707 X:154279616-154279638 TTGCCTCTTCCAGTTTCTGGTGG - Intronic
1200273076 X:154705663-154705685 TTTCTTCTTCTAGTTCTTGGAGG - Intronic
1200320826 X:155187250-155187272 TTGTTCCTTCCAGCTTCTGGAGG - Intergenic
1200750264 Y:6938447-6938469 TTGCTTTTTCTGGCTCCTGGAGG + Intronic
1201253996 Y:12089155-12089177 TTGCTTTTTCCAGCTTCTAGAGG + Intergenic
1201917453 Y:19197354-19197376 TTGATTCTTCCAGCTGGTGAAGG + Intergenic