ID: 1052443007

View in Genome Browser
Species Human (GRCh38)
Location 9:28521970-28521992
Sequence CTGTATCCATCGAGGGAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052442999_1052443007 14 Left 1052442999 9:28521933-28521955 CCACCACAAGCTAGAAGAAGCAA 0: 2
1: 7
2: 82
3: 402
4: 1090
Right 1052443007 9:28521970-28521992 CTGTATCCATCGAGGGAGCATGG No data
1052443001_1052443007 11 Left 1052443001 9:28521936-28521958 CCACAAGCTAGAAGAAGCAAGGG 0: 2
1: 2
2: 14
3: 143
4: 763
Right 1052443007 9:28521970-28521992 CTGTATCCATCGAGGGAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052443007 Original CRISPR CTGTATCCATCGAGGGAGCA TGG Intronic
No off target data available for this crispr