ID: 1052446154

View in Genome Browser
Species Human (GRCh38)
Location 9:28564348-28564370
Sequence TATTTAGAATTATCTACTCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 236}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052446154 Original CRISPR TATTTAGAATTATCTACTCC CGG (reversed) Intronic
910298553 1:85678817-85678839 TATTTATAATTTTCTACTAAAGG + Intronic
913041012 1:115023124-115023146 TGTTTAGAATTATCTTCTATTGG - Intergenic
914871284 1:151476812-151476834 TAATTAAAATTATCTAGTCTGGG - Intergenic
915850400 1:159315451-159315473 CATTTAGAATAATGTTCTCCAGG - Intergenic
916722331 1:167493867-167493889 TATCTAGAATTATTAATTCCAGG + Intronic
918642850 1:186864078-186864100 TATTTAGCATAATGTCCTCCAGG + Intronic
918757024 1:188351960-188351982 TCTTAAAAATTATCTACTCGAGG + Intergenic
919450184 1:197762829-197762851 CATTTAGCATAATGTACTCCAGG + Intronic
919618416 1:199836035-199836057 AATTTAAAATTATTTACTTCTGG - Intergenic
920239852 1:204538665-204538687 TATTTTGATTTATCTACTTGAGG + Intronic
921512760 1:216052595-216052617 CAGTTAGAATTACCTACTTCAGG + Intronic
923935708 1:238757448-238757470 GATTCAGAATTATTTACTCCGGG - Intergenic
924832161 1:247608104-247608126 TATTTAGCATAATGTCCTCCAGG + Intergenic
1063279940 10:4617020-4617042 CATTTAGACTTTTCAACTCCAGG + Intergenic
1064305819 10:14164991-14165013 TTTTTAGAAATATCTAATCCAGG - Intronic
1064908696 10:20376590-20376612 TATTTAGCATTATCTAATAAAGG - Intergenic
1065134018 10:22650683-22650705 TATTTTAAATTAACTTCTCCAGG + Intronic
1066076481 10:31882992-31883014 CATTAAGAAATATCTACTCTTGG + Intronic
1068246031 10:54369982-54370004 AATTTAAAATGAACTACTCCAGG + Intronic
1070423059 10:76257273-76257295 TATTAATAATTATCTGCTCTGGG + Intronic
1071222241 10:83482178-83482200 TACTTAGAATAATCTTCTCAAGG + Intergenic
1071430000 10:85599771-85599793 TTTTTAGAATTTTCTACCCTTGG - Exonic
1072020429 10:91394002-91394024 AATTTTTAATAATCTACTCCAGG - Intergenic
1072095498 10:92174884-92174906 TCTTTAGAAGTATCTTCTCTGGG + Intronic
1072996040 10:100244950-100244972 TATCTAGAATTATGTAATGCTGG - Intronic
1073351033 10:102819941-102819963 AATTTAGAGGTATCTCCTCCAGG - Intergenic
1074258396 10:111827133-111827155 TGTTAAGAATAATCTCCTCCTGG - Intergenic
1076930968 10:133531548-133531570 TATTTAGAATAACCTTCTGCTGG + Intronic
1078279770 11:9889637-9889659 TATTAAGAATTTTCCACACCTGG - Intronic
1080249340 11:30215467-30215489 TATTTAGCATTATGTCCTCCAGG - Intergenic
1080966737 11:37222348-37222370 TATTTTGGATTATTTACTACAGG + Intergenic
1081187082 11:40056914-40056936 TACTTAGAATAATGTCCTCCAGG - Intergenic
1082209121 11:49476080-49476102 TATTTTGAATTTTCTACTAGTGG - Intergenic
1084719849 11:70897879-70897901 TATTTAGAATTATTGGCTGCTGG + Intronic
1085217901 11:74848498-74848520 TAATTAGGATTCTCTCCTCCTGG + Intronic
1086640502 11:89149150-89149172 TATTTTGAATTTTCTACTAGTGG + Intergenic
1086805552 11:91237264-91237286 TATTTTAAATTATTTACTCTAGG + Intergenic
1087414712 11:97839501-97839523 GATTTAGAATTATGTACATCTGG + Intergenic
1087840645 11:102917577-102917599 TATTTAGCATGATCTCCTCAAGG - Intergenic
1088166787 11:106948547-106948569 TATTTAGAATAAGCTGCTTCTGG - Intronic
1090541809 11:127714444-127714466 CATTTTGAATTAACGACTCCTGG - Intergenic
1092172110 12:6380378-6380400 TATTTAGAAGAATCCATTCCTGG + Intronic
1092366968 12:7884277-7884299 TAATTAAACTTATTTACTCCTGG + Intronic
1092633353 12:10411263-10411285 TATTTACAATTTTCTACTAAAGG + Intergenic
1101236278 12:102793411-102793433 CATCTTGAATTATATACTCCAGG - Intergenic
1102409974 12:112709247-112709269 TATTTAAAAATATTTACTCTTGG + Intronic
1104452733 12:128884260-128884282 TATTTCGCATTATGTCCTCCAGG - Intronic
1105933340 13:25073701-25073723 TATTTAAAAGTATCAACTTCTGG - Intergenic
1106131548 13:26943857-26943879 AACTGAGCATTATCTACTCCAGG + Intergenic
1106236889 13:27869969-27869991 CATTTAGAATTCTCTCCTTCCGG - Intergenic
1107450233 13:40501659-40501681 TACTTAAAATTATGTCCTCCAGG - Intergenic
1107920792 13:45205059-45205081 TATTTAGCAGTACCTACTCCAGG - Intronic
1109227767 13:59717314-59717336 TATTTTGAAGTATCTTCTCAGGG + Intronic
1109393387 13:61722688-61722710 TATATACAACTATCTACTCATGG + Intergenic
1111203484 13:84971879-84971901 TACTTAGAATAATGTCCTCCAGG + Intergenic
1112881547 13:104112333-104112355 TGTTTAGAAATATCAACTTCAGG - Intergenic
1114351966 14:21862546-21862568 TATATATAATTTTTTACTCCTGG + Intergenic
1115351962 14:32405309-32405331 TATTTAAAATGATCTGCTCTAGG - Intronic
1115639622 14:35325536-35325558 TATTAAAAGTTAGCTACTCCAGG + Intergenic
1115701639 14:35959193-35959215 TACTTAGAAGAATCTTCTCCTGG + Intergenic
1116341658 14:43730885-43730907 CATTTAGCATTATGTCCTCCAGG - Intergenic
1120146821 14:80987932-80987954 TATTAGAAATTATCTACTCTAGG + Intronic
1121903725 14:97720259-97720281 CATTTAGAATAATGTCCTCCAGG + Intergenic
1124549095 15:30661411-30661433 TTTTTAGAATTTTCTGCTACAGG + Intronic
1124990831 15:34671880-34671902 TATTTAGAAGTATCTAGACTAGG - Intergenic
1125013878 15:34911058-34911080 CATTTAGCATAATGTACTCCTGG + Intronic
1125096751 15:35863221-35863243 CATTTAGAATTATATCTTCCTGG + Intergenic
1127085434 15:55420156-55420178 GATTTAGCTTTATCTTCTCCAGG - Intronic
1127649089 15:60988780-60988802 GACCTAGATTTATCTACTCCAGG + Intronic
1129286772 15:74531866-74531888 TTTTTAGGATTAACTACCCCAGG - Intergenic
1130362586 15:83205452-83205474 TATTTGGAATTATCACTTCCAGG + Intronic
1131857096 15:96609164-96609186 TATTTAGATTTTTCTACTGAGGG + Intergenic
1139245664 16:65440549-65440571 TATTTAGAATTGTCAAACCCAGG + Intergenic
1143744729 17:8983865-8983887 TATTTAAAATTAACTGCTCTTGG - Intergenic
1148088019 17:45006428-45006450 GATTTGGATTTATCTGCTCCTGG - Intergenic
1148570996 17:48668899-48668921 TATTAAGAATTAACCACTACAGG - Intergenic
1148799058 17:50211598-50211620 TCTTTACATTTCTCTACTCCTGG + Intergenic
1149411154 17:56408659-56408681 TATTTCAAATTATTTACACCAGG + Intronic
1154206864 18:12344970-12344992 TATTCAGAATTATCAAATACTGG + Intronic
1157668983 18:49512436-49512458 TTTTTAAAAAAATCTACTCCTGG - Intergenic
1158920211 18:62183732-62183754 TATTTAGAATTATCATTTCAAGG + Intronic
1159333279 18:67029804-67029826 TATTCAGAATTATCTTACCCAGG - Intergenic
1159727631 18:71982029-71982051 GATTTAGAACTCTCTCCTCCTGG + Intergenic
1160247946 18:77175274-77175296 TTTCTAGAACTATCTATTCCAGG - Intergenic
1160900060 19:1423413-1423435 TCTTTAGATTTCTCTTCTCCAGG + Intronic
1163662512 19:18587282-18587304 GATTCAGAATTAACCACTCCAGG + Intronic
1164766536 19:30776886-30776908 TATTTTGAATTAACTACTAATGG - Intergenic
1164796239 19:31033798-31033820 CATTTAGAATTATTTCCTCTTGG + Intergenic
1165205559 19:34182419-34182441 TATTTAGAATTCTCTATTCCTGG + Intronic
1165315462 19:35052724-35052746 CATTGTGAATTATTTACTCCTGG + Intronic
925852784 2:8099079-8099101 TATTTAGCATCATCTAGTTCAGG + Intergenic
926671687 2:15582656-15582678 TATTCAGAATTGTTTTCTCCAGG + Intergenic
929166129 2:38883761-38883783 TATTTAGAATAATGTCCTCAGGG + Intronic
929975947 2:46634699-46634721 TATATGTAGTTATCTACTCCTGG - Intergenic
930350316 2:50245125-50245147 CATTTAGAAGTATCCCCTCCAGG + Intronic
930780565 2:55221456-55221478 TATCTAGAATTATCTAGTCATGG - Intronic
931917015 2:66967329-66967351 TTTTTAGTATTTTCTATTCCAGG - Intergenic
932811701 2:74831640-74831662 TATCTAGAATATTCTTCTCCAGG - Intergenic
934219742 2:90071749-90071771 TAATTAGAAATATCTGGTCCTGG + Intergenic
938099371 2:128487838-128487860 TATTTAGTAGTACCTCCTCCAGG + Intergenic
939162233 2:138604330-138604352 CATTTAGAATTATCTGCCTCAGG - Intergenic
941097466 2:161255172-161255194 TATTTACAATGATTTACCCCTGG + Intergenic
941172731 2:162159477-162159499 TATTTAGCATAATCTTCTCAAGG + Intergenic
941850683 2:170177127-170177149 TACCTAGATTTATCTGCTCCAGG + Intergenic
941988630 2:171533069-171533091 TATTTAGAATTATTTGGGCCGGG + Intronic
942934380 2:181537205-181537227 GATTTAGAACTGTCTTCTCCAGG + Intronic
942965473 2:181888129-181888151 TATATAGAATTTTTTTCTCCAGG + Intergenic
943542026 2:189227653-189227675 TATTTATAATTATATCTTCCTGG - Intergenic
944642157 2:201738806-201738828 AATCAAGAATTATCTATTCCAGG - Intronic
945278904 2:208016782-208016804 TATTTGGAATTAGCCAATCCGGG + Intronic
945334207 2:208572391-208572413 TATATAGAATTGTCTAATTCTGG - Intronic
946693499 2:222328551-222328573 TACTTAGAATAATCTCCTCAAGG + Intergenic
947107579 2:226683647-226683669 TACTTAGTCTTTTCTACTCCAGG - Intergenic
1169473871 20:5912417-5912439 TATTTTGACTTCTGTACTCCAGG + Intronic
1169689829 20:8317912-8317934 TTTTTAAAATTATTTTCTCCTGG + Intronic
1170224818 20:13980848-13980870 CATTTAGTATAATGTACTCCAGG - Intronic
1177601120 21:23316232-23316254 TATGTATAATTATCTGCTGCAGG + Intergenic
1182063432 22:27414079-27414101 TATTCAGAATTCTTTTCTCCAGG - Intergenic
1184804622 22:46785652-46785674 TATATAGAATTGTCTATTCTAGG + Intronic
949565380 3:5240042-5240064 TATTCAGAGTTGTCTACTTCTGG + Intergenic
951639927 3:24825822-24825844 TATTTGAAATTGTTTACTCCTGG - Intergenic
953490995 3:43350869-43350891 TATATATAATTATGTACTTCTGG + Exonic
954820600 3:53323316-53323338 TATTAAGCATTATCTACTGCAGG + Intronic
955579380 3:60402409-60402431 AATTTATTATTATCAACTCCAGG + Intronic
956163194 3:66376187-66376209 TATTGAGATGAATCTACTCCTGG + Intronic
957642171 3:82868684-82868706 TATTTACAATTATATTTTCCAGG - Intergenic
960215405 3:115029363-115029385 GATTTAGAATTATTTAATCAAGG - Intronic
962039994 3:131696793-131696815 TATTTACCATTGTCTATTCCAGG - Intronic
962287095 3:134095540-134095562 TATTTACATTTTTCTCCTCCAGG + Intronic
962620941 3:137177953-137177975 TGTTAAAAATTATCTGCTCCGGG + Intergenic
963012306 3:140782104-140782126 TCTTTAGATTTATCTTCTCTGGG - Intergenic
964169536 3:153753366-153753388 TATTTAGATTTATTTACTGTGGG - Intergenic
964420141 3:156493548-156493570 CATTTAGAATTATCAAAACCTGG + Intronic
964744936 3:160003412-160003434 TATTTAGATTTTTTTATTCCTGG - Intergenic
964963183 3:162454433-162454455 TATTTGGAATTATCTAATGCAGG - Intergenic
965032046 3:163383511-163383533 TATTTAAATTTATCTAGTCCTGG - Intergenic
965246937 3:166284631-166284653 TATTTAAGATTATGTCCTCCAGG - Intergenic
965274984 3:166670806-166670828 TATTGAGACTTAACTAGTCCAGG + Intergenic
968740223 4:2324745-2324767 TCTTTGGTTTTATCTACTCCTGG - Intronic
969990640 4:11258909-11258931 TATTTAGCATAATTTCCTCCAGG - Intergenic
970397969 4:15689916-15689938 AATTAAAAATTATATACTCCAGG - Exonic
970738644 4:19205315-19205337 AATTTAGAATTATCTAGACTTGG - Intergenic
971492388 4:27226777-27226799 TATTTGCAGTTATCTAATCCAGG + Intergenic
972887941 4:43516105-43516127 TATTTATAATTATCTAAAACTGG - Intergenic
974242985 4:59275157-59275179 TATTTTGAATTATTTTTTCCAGG - Intergenic
974805264 4:66871472-66871494 TATTAAAAATGATCCACTCCAGG + Intergenic
974903437 4:68030184-68030206 TTTTTAAAGTTATCTTCTCCTGG - Intergenic
975150979 4:71020706-71020728 TGTTTAGAATTATAAACTCATGG + Intronic
975353711 4:73374851-73374873 TACTAAGAATTACCTACTCCTGG - Intergenic
975996854 4:80325279-80325301 TAGCTGGAATTATCTACTCTTGG + Intronic
976521481 4:86032827-86032849 TATTGAGAAATAACTACTCACGG + Intronic
977653890 4:99499725-99499747 TATATAGAAATATTTACTACTGG - Intergenic
978894563 4:113871470-113871492 TATTTAGAAATAACTACCACAGG - Intergenic
979762284 4:124421093-124421115 TAATTAGAAGTATTTACTGCAGG - Intergenic
979821176 4:125173400-125173422 TATTTAGGCTTCTCTTCTCCAGG + Intergenic
982105856 4:152011625-152011647 GTTTTAGGAGTATCTACTCCTGG + Intergenic
982144575 4:152370606-152370628 TTTTTAGCATTATCTACACTTGG + Intronic
982751479 4:159167227-159167249 TGTTTAGATTTCTCTACTTCTGG - Intronic
983078379 4:163354338-163354360 TATTTAGAAATATTTAATTCAGG + Intergenic
983164748 4:164461160-164461182 TATTTGGAATTTTCCACTTCTGG - Intergenic
983351154 4:166590351-166590373 TATATAGCATTATTTACCCCTGG - Intergenic
983418747 4:167490944-167490966 AATTTACTATTATCTCCTCCTGG + Intergenic
983709324 4:170694507-170694529 TATTTGGAATTATATACTGTGGG - Intergenic
984115682 4:175678081-175678103 TATTTTGAATTCCCCACTCCAGG + Intronic
984979856 4:185269887-185269909 TATTTTGAATGATCTACCACTGG + Intronic
986328228 5:6696819-6696841 TTTTGAGAATTGTCTACTCATGG + Intergenic
989179534 5:38562727-38562749 TATTTAGAATAATATATTCAAGG - Intronic
989668480 5:43886025-43886047 TACTTTGCATTATCTCCTCCTGG - Intergenic
989757371 5:44971581-44971603 TATTCAGAATTTTATATTCCAGG - Intergenic
990140372 5:52696315-52696337 TATTTAGTATTATGTACGCTAGG - Intergenic
991062064 5:62386962-62386984 TGTTTTGATTTATTTACTCCAGG + Intronic
991510144 5:67367020-67367042 TCTTCAGAATTATCTATTTCTGG - Intergenic
993202874 5:84840352-84840374 TGTTTATAATTATCTAGTCTCGG + Intergenic
993846614 5:92952631-92952653 TATTTTGAATTATTTTCCCCAGG + Intergenic
993961202 5:94298272-94298294 TGTTAAGAGTGATCTACTCCAGG + Intronic
994579583 5:101622954-101622976 AATTTAGAAATATTTCCTCCTGG + Intergenic
994649499 5:102508688-102508710 TATATAGAATTATCTATACTTGG - Intergenic
997168728 5:131691814-131691836 AATCAATAATTATCTACTCCTGG + Intronic
999539159 5:152553076-152553098 ACTTTAGCATTATGTACTCCAGG - Intergenic
1000031324 5:157404402-157404424 TGTTTAGAATTATTTGATCCTGG - Intronic
1000375168 5:160574127-160574149 TATTTAGAATTTTCTACATCTGG + Intronic
1000733211 5:164862749-164862771 TTTTTAAAATAATTTACTCCAGG + Intergenic
1003450306 6:6224898-6224920 CATTTAGGTTTGTCTACTCCAGG + Intronic
1004787210 6:18982612-18982634 TAATGAGGATTTTCTACTCCAGG - Intergenic
1006247291 6:32748755-32748777 CATTTATAATTATTTTCTCCCGG - Intergenic
1008814706 6:55551362-55551384 TATTTCCAATTATATACTCAGGG - Intronic
1009554261 6:65141565-65141587 TATTTAGAATTATCCACTTAGGG - Intronic
1009640453 6:66328792-66328814 TATTTAGTGTTAAGTACTCCAGG - Intergenic
1009993658 6:70875620-70875642 AATTTAGAATTATTTTCTTCTGG + Intronic
1010060972 6:71622412-71622434 CATTTAAAGTTTTCTACTCCTGG + Intergenic
1010340018 6:74739086-74739108 TTTTTAGAATTATCAACCACTGG - Intergenic
1010732772 6:79408808-79408830 TATTTGGAGTTATTTACTCAGGG - Intergenic
1011096139 6:83665860-83665882 TTTTTAAAATTATAAACTCCAGG + Intronic
1011888904 6:92132272-92132294 AATTTAGAGTTATCTACTCTGGG - Intergenic
1013759565 6:113500868-113500890 TATTTGGAATTCTCTCCTCTAGG - Intergenic
1016097159 6:140052428-140052450 TATTTAGAATTCTGTACATCTGG - Intergenic
1016729439 6:147412748-147412770 TATTTAGCATAATGTCCTCCAGG - Intergenic
1017519741 6:155191475-155191497 TATTTAGAATTCTCCAGGCCAGG - Intronic
1018458391 6:163972915-163972937 TATTTAGAAGTATGTAATGCGGG - Intergenic
1018621656 6:165734813-165734835 TATTTAAAATTATCTGTTACTGG - Intronic
1019680158 7:2343224-2343246 TATTTAAAATTATCAAGGCCAGG - Intronic
1020703044 7:11507526-11507548 TATTTAGGATTATTTAATCCAGG + Intronic
1021369665 7:19827638-19827660 TACTTAGAATAATGTCCTCCAGG - Intergenic
1021448655 7:20760440-20760462 TATTTAGGATTTTCTAGGCCAGG - Intronic
1024319995 7:48055744-48055766 TACTTAGACTAATGTACTCCAGG + Intronic
1025770459 7:64500503-64500525 TATTTAGCATCATGTCCTCCAGG - Intergenic
1027722904 7:81767983-81768005 ATTTTAGAATTATCCACTTCAGG + Intronic
1028098601 7:86793113-86793135 TGTTTACAATTCTCTACACCTGG + Intronic
1029196120 7:98806643-98806665 ACTTCAGAGTTATCTACTCCAGG - Intergenic
1031345407 7:120659605-120659627 TACTTAGTATTCTCTACTCCTGG - Intronic
1031394693 7:121258845-121258867 TATTTTGAACTATTTATTCCTGG - Intronic
1032856701 7:135840263-135840285 TATTCAGTGTTATCTTCTCCAGG + Intergenic
1033044557 7:137949836-137949858 TATTGAGAGTGATCAACTCCAGG + Intronic
1035831931 8:2704913-2704935 AATTTTCAATTATCTACTACAGG - Intergenic
1038222008 8:25618279-25618301 TATTTAGAATTATATCTTCTTGG - Intergenic
1038367075 8:26947375-26947397 CTTTTAGAATTATCTTCTTCAGG + Intergenic
1038587710 8:28805047-28805069 TATTTTAAATTACTTACTCCTGG - Intronic
1039298464 8:36183324-36183346 TACTTAGCATAATCTCCTCCAGG + Intergenic
1042468397 8:69155043-69155065 AATTTAGATTGATCTACTCCAGG - Intergenic
1043815279 8:84793664-84793686 TATTGAATATTATCTACTCCTGG - Intronic
1044737285 8:95292179-95292201 TACTTAGCATTATGTACTCAAGG - Intergenic
1045576930 8:103432928-103432950 TATTTAGAATGATGTAGACCAGG + Intronic
1045584805 8:103521800-103521822 AATTTTGAATTATCCACTCTTGG - Intronic
1046139953 8:110078561-110078583 GATTTAGAATTATCTAAAACTGG + Intergenic
1052446154 9:28564348-28564370 TATTTAGAATTATCTACTCCCGG - Intronic
1052907165 9:33845710-33845732 CATTTAGAATTTTCTAGGCCGGG + Intronic
1054708976 9:68491938-68491960 TATAAAGAATTACCTTCTCCTGG + Intronic
1055188241 9:73482639-73482661 TATTTAAAATTGTTTACTACAGG + Intergenic
1055194267 9:73567949-73567971 TATTTAGAATTGCCAGCTCCTGG - Intergenic
1055346850 9:75348965-75348987 TCTTTAGAATTCTCTTCTTCAGG + Intergenic
1055403266 9:75947149-75947171 TATTTGGAACTACCTTCTCCTGG - Intronic
1055407756 9:75992551-75992573 TATTTAAAGTTATTTACTACGGG - Intronic
1060778819 9:126396752-126396774 TATTTAAACTTAACTACCCCTGG + Intronic
1186442347 X:9597005-9597027 TATTTATAACTAGATACTCCGGG - Intronic
1186902060 X:14066820-14066842 TATTTAAAATTATCTCATCTTGG - Intergenic
1187269671 X:17768482-17768504 TTTTTAAAATTATTTACTCAAGG - Intergenic
1187801526 X:23068790-23068812 TCTTTAGAATCATCTATTTCAGG + Intergenic
1187987885 X:24834277-24834299 TTTTGAGAATTATCTTCTCCAGG + Intronic
1188234015 X:27704379-27704401 TATTTAGAATAATATTCTCCAGG - Intronic
1188920979 X:35976906-35976928 TATGTGGAATTATAGACTCCAGG - Intronic
1191831186 X:65418341-65418363 TATTTAAAATTATCCATTACAGG - Intronic
1193063023 X:77226462-77226484 TTTTGAGAATTTTCTACTCATGG - Intergenic
1194351922 X:92831337-92831359 TAGTTAGAATTTTTTATTCCAGG + Intergenic
1196039817 X:111190112-111190134 TTTCTAGAATTATCAAATCCCGG + Intronic
1196301692 X:114055962-114055984 TATTAAGAATTTCCTTCTCCTGG + Intergenic
1196558207 X:117116640-117116662 TATTTAAAGTTTTCTACTGCTGG + Intergenic
1196961102 X:121002378-121002400 TAATTAGAATTTTCAACTCTTGG + Intergenic
1197055362 X:122112662-122112684 CATTTAGATTTATCTTCTGCAGG + Intergenic
1197249970 X:124205298-124205320 TACTTAGAATTATCAAGGCCAGG - Intronic
1198587184 X:138135457-138135479 TAATTAGAATAATTTACTCATGG + Intergenic
1199135142 X:144241108-144241130 TATTTATAAAGTTCTACTCCAGG - Intergenic
1199314058 X:146356782-146356804 TATTCAGAAAAATTTACTCCAGG - Intergenic
1199891772 X:152090786-152090808 TATTTAGTATTGTTAACTCCTGG + Intergenic
1200660231 Y:5948028-5948050 TAGTTAGAATTTTTTATTCCAGG + Intergenic
1200693506 Y:6333260-6333282 ACTTTAGAGTTTTCTACTCCAGG + Intergenic
1201041769 Y:9841465-9841487 ACTTTAGAGTTTTCTACTCCAGG - Intergenic