ID: 1052446161

View in Genome Browser
Species Human (GRCh38)
Location 9:28564443-28564465
Sequence CTGTAATCTAAGATAGAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 158}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052446161 Original CRISPR CTGTAATCTAAGATAGAGGT AGG (reversed) Intronic
901384070 1:8895516-8895538 CTGTAATCCCAGACCGAGGTGGG + Intergenic
907100135 1:51824825-51824847 CTGAAATTTAAAATAGAGATGGG + Intronic
907636165 1:56136392-56136414 CTGTAGTTGAAGTTAGAGGTGGG + Intergenic
908057877 1:60310979-60311001 CTCTAATCAAAGACAGAGATTGG + Intergenic
908935488 1:69371318-69371340 CTGTGATCTTAGAGAGTGGTTGG + Intergenic
910333484 1:86102729-86102751 CTGTAGTCCAAGAGAGTGGTTGG + Intronic
910353312 1:86324751-86324773 CTGTCATCTATTATAGAGGTTGG - Intergenic
918825898 1:189324639-189324661 CTGTATTCTACTCTAGAGGTGGG - Intergenic
921275859 1:213519305-213519327 CTGTAATGTTAGATTGAGGATGG + Intergenic
922249883 1:223838851-223838873 TGGTAATATTAGATAGAGGTGGG + Intronic
923006675 1:230055459-230055481 CAGTAATCTAGAATAGAGCTTGG + Intergenic
923134620 1:231107230-231107252 ATGTGATCTAAGTTAGAGCTCGG + Intergenic
923700914 1:236299736-236299758 CGGTAATTTAAAATAGAGGACGG + Intergenic
923824414 1:237484085-237484107 CTTTCGTCTAAGCTAGAGGTAGG - Intronic
1066694697 10:38067338-38067360 CTGGAGTCTAGGATACAGGTGGG - Intergenic
1066997816 10:42579841-42579863 CTGGAGTCTAGGATACAGGTGGG + Intronic
1072701620 10:97645953-97645975 CTGTATTCTATGGTATAGGTTGG - Intronic
1074593666 10:114839970-114839992 CTGTAATCTAAAGTAGAGTAAGG + Intronic
1079212481 11:18475067-18475089 CTGTAATCTTTAGTAGAGGTGGG - Intronic
1083542016 11:63518102-63518124 CTGTAATCTCACATGGTGGTAGG - Intergenic
1088960334 11:114657219-114657241 CTGCAATCAGAGATAGAGGTAGG - Intergenic
1090875268 11:130783461-130783483 CTGCCATTTAAGAAAGAGGTGGG + Intergenic
1091263261 11:134250726-134250748 AGGTAACCTAAGATTGAGGTTGG + Intronic
1093513846 12:19961698-19961720 ATCTAAGCTAAGAAAGAGGTAGG - Intergenic
1094257708 12:28453850-28453872 CTGTAACCTCACATAGATGTGGG + Intronic
1095130739 12:38539355-38539377 CAGTAATCCAGGATAGAGATGGG + Intergenic
1098057921 12:66527956-66527978 CTTGAACCTAAGATAGAAGTTGG + Intronic
1098097813 12:66978846-66978868 CTGTAATTTAAGAAAGAACTTGG - Intergenic
1098760455 12:74418370-74418392 TTCTAATCTAAGGTAGGGGTTGG - Intergenic
1098974323 12:76886731-76886753 CTGTTCTCTAAGTTAGAGTTTGG - Intergenic
1099049875 12:77768755-77768777 CTGCAATCTCAGAATGAGGTAGG + Intergenic
1099562369 12:84193853-84193875 GTTTAATCTGAGACAGAGGTTGG - Intergenic
1105071622 12:133237110-133237132 CTGGCTTCTAAGACAGAGGTAGG + Intergenic
1106649236 13:31671406-31671428 CTCTAATCAAAGGCAGAGGTTGG - Intergenic
1107306533 13:39026388-39026410 CTGTAATATAAGAAAGAAGAGGG + Intronic
1109695951 13:65957658-65957680 ATGTAATCTATGATATAGTTGGG + Intergenic
1111181106 13:84666322-84666344 CTGAAATCAAAGATTCAGGTTGG + Intergenic
1112131595 13:96530612-96530634 CTATAATCTCAGTTTGAGGTGGG - Intronic
1113198440 13:107837059-107837081 CTTTAATCCATGATAGAGCTTGG + Intronic
1113350702 13:109526405-109526427 CTGGAATGTAAGGTAGTGGTAGG - Intergenic
1115044943 14:28980378-28980400 CTGTGATCTGAGAGAGTGGTTGG - Intergenic
1117706776 14:58478047-58478069 CTGTCATCTAGGCTAGAGGCTGG + Intronic
1117847914 14:59932974-59932996 CTGTAGTCAAAGAGATAGGTAGG - Intronic
1118079638 14:62343596-62343618 CTCTAAACTAAGACAGAGTTTGG - Intergenic
1118389231 14:65282244-65282266 CTGTAATCTCAGAGAGAGGATGG - Intergenic
1121734067 14:96205748-96205770 CTTTATGCAAAGATAGAGGTAGG + Intronic
1134214034 16:12302106-12302128 CAGTGATCTAAGACAGAGATGGG + Intronic
1137560928 16:49502018-49502040 CTGGAATCTAAAATAAAAGTTGG + Intronic
1143208160 17:5161319-5161341 CTGTAAGCCCAGATAGAGGATGG + Intronic
1143395547 17:6592633-6592655 CTGTGATTTGAGGTAGAGGTTGG - Intronic
1143740026 17:8945691-8945713 CTGTAATGTAAAGGAGAGGTGGG - Intronic
1143858615 17:9871570-9871592 CTGTCATCTCAGAAAGAGGAAGG - Intronic
1149223741 17:54444392-54444414 CTGTATTCTAAGAGTGAGGATGG - Intergenic
1149814403 17:59708347-59708369 CTGTAATAAGATATAGAGGTCGG - Intronic
1149872241 17:60193117-60193139 CTGTAAGCCCAGATAGAGGATGG - Intronic
1150532478 17:65998844-65998866 CAGTAATTTAAGCTAGAAGTTGG + Intronic
1150865264 17:68842514-68842536 CTGTGGTCAATGATAGAGGTAGG + Intergenic
1151603692 17:75122978-75123000 CTGTAATTTAAGATGAAGGAGGG - Intronic
1152037797 17:77883933-77883955 CTGTAGTCCAAGAGAGAGGCAGG - Intergenic
1154459739 18:14569352-14569374 CTGTAATCTAACATTGTGGGAGG - Intergenic
1155896413 18:31333472-31333494 CATAAATCTATGATAGAGGTAGG - Intronic
1159173788 18:64808247-64808269 CTGTTCTTTGAGATAGAGGTAGG + Intergenic
1159480074 18:68979102-68979124 CTGTATTCTAAGTGGGAGGTGGG + Intronic
1159543914 18:69815412-69815434 CAGTAATATACGATAGAGATAGG + Intronic
1163388114 19:17012593-17012615 CTGTAATCTGAGGCTGAGGTGGG - Intronic
1165458968 19:35933005-35933027 CTGTAATCCCAGGTTGAGGTGGG + Intergenic
1167255893 19:48428483-48428505 CTGTAATCTCAGCTACAGGAGGG - Intronic
1167514770 19:49916807-49916829 CTGTGATCCCAGATAGAGGTGGG + Intronic
927001828 2:18803560-18803582 CTGTAAAATAAGATAGAAGAAGG - Intergenic
930724552 2:54669922-54669944 CTGAACTCTGAGATAGGGGTTGG + Intronic
931829228 2:66033803-66033825 ATGTATTCTAAGACAGGGGTGGG - Intergenic
932117852 2:69069297-69069319 CTCTTACCTAAGACAGAGGTGGG - Intronic
933626828 2:84610617-84610639 CTGAAGTCTAAGAAAGAGATTGG - Intronic
934218854 2:90062593-90062615 CTGTGGTCCAAGAGAGAGGTTGG + Intergenic
935670659 2:105554292-105554314 CTGTAATCAATGCTAGAGGAAGG - Intergenic
937594465 2:123657214-123657236 TTGTAATTTTACATAGAGGTTGG + Intergenic
939108115 2:137973559-137973581 CTGTAAACTAAGACAGAAATGGG - Intronic
939353373 2:141069751-141069773 ATATTATCTAAGACAGAGGTGGG - Intronic
942745447 2:179226760-179226782 CTGAAATCTAAAATAGATGTTGG + Intronic
946307965 2:218866604-218866626 CTGTAATCTGGGAGGGAGGTGGG + Intronic
947025379 2:225732215-225732237 CTGTATTCAAAGATAGAGGTAGG + Intergenic
947254623 2:228148396-228148418 CAGTCATCTAAGATAGAAGAAGG + Intronic
1169413085 20:5391358-5391380 CTGTAGTCGAAGATAAAGTTAGG - Intergenic
1172421122 20:34818858-34818880 CTGTTGTCTAAGAGAGTGGTTGG - Intronic
1173972841 20:47165786-47165808 CTGGAATCTGAGAGAGGGGTTGG - Intronic
1180677744 22:17599608-17599630 CTGGAATAAAAGATAGAAGTGGG + Intronic
1181923117 22:26336016-26336038 CTCTTATATAAGCTAGAGGTGGG + Intronic
1182628857 22:31668983-31669005 CTGTAATCTCAGCTATAGGGAGG + Intergenic
949489804 3:4577921-4577943 CAGTAATGTAAGATTGAGGTGGG - Intronic
950743726 3:15070068-15070090 ATAAAATCTGAGATAGAGGTTGG - Exonic
952499281 3:33944884-33944906 CTGTAATCTAGGATAGTAGAGGG - Intergenic
953332891 3:42069207-42069229 CTGTAGTCTCAGCTACAGGTGGG + Intronic
954724229 3:52593775-52593797 CTGTGGTCTAAGAGAGTGGTTGG + Intronic
955947922 3:64213200-64213222 CTGTAATCTCAGCTAGATGGTGG - Intronic
958876264 3:99621112-99621134 CAGTAATCTAAGACAGATCTGGG + Intergenic
958958813 3:100489879-100489901 CTGTAGTCTCAGGTACAGGTGGG - Intergenic
959952523 3:112195402-112195424 CTCTAATCAAAGACAGAGATTGG - Intronic
964034960 3:152184425-152184447 CTTTCCTCTAACATAGAGGTTGG - Intergenic
965397947 3:168183104-168183126 CTGTAATGTAACTTAGTGGTTGG + Intergenic
965498280 3:169425592-169425614 CTGTAAAGTAATATAGTGGTCGG - Intronic
967439041 3:189485652-189485674 CTTTATTCTAAGAAAGAGGAGGG - Intergenic
971319271 4:25592211-25592233 CTGTAATCCCAGGTAGAGATGGG + Intergenic
972791511 4:42375619-42375641 TTGTAATCTAAGAGGGAGGCAGG - Intergenic
973755360 4:54068376-54068398 CTGTGTTCTAAGATAGTGGAAGG - Intronic
974064206 4:57062582-57062604 CTTTATTCTAAGATATGGGTAGG - Intronic
975088149 4:70367659-70367681 TTCTAAGCTAAGATAGAGATAGG + Intergenic
977183438 4:93905887-93905909 CTGTAATCCCAGATATTGGTAGG - Intergenic
981988061 4:150881655-150881677 CCTGAATCTAAGATAAAGGTGGG + Intronic
984413806 4:179431641-179431663 CTGGACTGTAAGATGGAGGTGGG + Intergenic
985941177 5:3137456-3137478 CTGTAATCCAAGGCAGAGGCAGG + Intergenic
989013437 5:36900951-36900973 CTGGAATCTAAAATAAAGGCTGG - Intronic
989824846 5:45840630-45840652 CTTTAATCTAAAATAGACATTGG - Intergenic
992965845 5:81999181-81999203 CTGTAGTCTAAGAGTGTGGTTGG - Intronic
993442659 5:87975805-87975827 CTGTGGTCTAAGATTAAGGTTGG + Intergenic
994370207 5:98959046-98959068 CTGTAATCTCAGATACTGGGAGG + Intergenic
994974561 5:106785357-106785379 TTGTACTCTACTATAGAGGTGGG + Intergenic
997656705 5:135560489-135560511 ATTTAATATAAGATGGAGGTAGG - Intergenic
1002140143 5:177133244-177133266 CTGTAACCTAAGATGGAGGCCGG + Intronic
1003308294 6:4947696-4947718 CTGGAAGCTAAGATAGATTTGGG + Intronic
1003863118 6:10339957-10339979 CTGGAATTTAAGATAAAGATCGG - Intergenic
1004092787 6:12521832-12521854 CTGGAACCTAAGATAAAAGTTGG - Intergenic
1004485331 6:16060993-16061015 CTGAAATCTAAGAGAAATGTAGG + Intergenic
1006565812 6:34956107-34956129 GTGGAACCAAAGATAGAGGTTGG - Intronic
1007314592 6:40976594-40976616 CTGTGATCTGAGAGAGTGGTTGG + Intergenic
1009413558 6:63393297-63393319 CTGTAATCTCACCTACAGGTTGG - Intergenic
1011101045 6:83722903-83722925 ATGTAATCTTAGATAGGGGGTGG + Intergenic
1011634784 6:89361378-89361400 CTGTAATTTATGATAAAAGTAGG + Intergenic
1012622532 6:101363466-101363488 CTGCAATATAAGATACATGTTGG - Intergenic
1015119265 6:129683650-129683672 ATGTAATGGAAAATAGAGGTTGG + Intronic
1017030576 6:150217932-150217954 ATGTAATCAAAGCTGGAGGTTGG - Intronic
1018436834 6:163767533-163767555 CTGTTATATAATAAAGAGGTGGG - Intergenic
1019898657 7:4002456-4002478 CTGAACACTAAGATACAGGTCGG + Intronic
1020721881 7:11755534-11755556 CTGTCACCTATGATAGAGATAGG + Intronic
1020808812 7:12826185-12826207 TTGTAATCTAATGTTGAGGTTGG + Intergenic
1022041361 7:26584746-26584768 CTGTAATCTGCGCGAGAGGTAGG - Intergenic
1022687554 7:32610666-32610688 CTGTAATCCCAGCTAGAGGCAGG + Intergenic
1025789546 7:64676225-64676247 CTGTGATCTAAGTTTGTGGTTGG + Intronic
1025822870 7:64986341-64986363 CTGTTATGTAAGAGGGAGGTAGG + Intronic
1026428006 7:70315833-70315855 CAATAATCTAAGCTGGAGGTAGG - Intronic
1028075103 7:86502743-86502765 CTCTTACCTAAGATAGAGGGAGG - Intergenic
1029972431 7:104802369-104802391 CTGTAATCCCAGATACTGGTGGG + Intronic
1031699739 7:124908731-124908753 TTGTATTCTATGATAGATGTTGG - Intronic
1036567243 8:9948114-9948136 GTGTCATCTAAAATGGAGGTGGG - Intergenic
1038235263 8:25746695-25746717 CCTTATTCTAACATAGAGGTGGG - Intergenic
1039888177 8:41667275-41667297 CTGGAGTCTAAGGTTGAGGTAGG + Intronic
1040433119 8:47363450-47363472 CTGTAATCTCAGGCTGAGGTGGG - Intronic
1042304595 8:67317926-67317948 CTGTAATCTACCATAGAAATAGG + Intronic
1043798441 8:84576938-84576960 CTGTAAACTAACATGAAGGTTGG - Intronic
1043824424 8:84908407-84908429 GTGGAATCTAAAACAGAGGTAGG - Intronic
1046810703 8:118530220-118530242 CTGGAACCTAACATAGAAGTTGG - Intronic
1049104363 8:140602412-140602434 TTGTAATTTAAGATAAATGTGGG - Intronic
1051599999 9:18863098-18863120 CTGTACTGTAAGATAGAGTTTGG - Intronic
1051891617 9:21948101-21948123 CTGTGGTCTAAGATTGTGGTTGG - Intronic
1052094379 9:24366921-24366943 CTGTGGTCTAAGAGAGCGGTTGG + Intergenic
1052446161 9:28564443-28564465 CTGTAATCTAAGATAGAGGTAGG - Intronic
1056201747 9:84283723-84283745 CTCTTATCTCAGATGGAGGTTGG + Intronic
1056974879 9:91243559-91243581 CTGCAAGATAAGATTGAGGTGGG - Intronic
1058284469 9:103158869-103158891 CTGTGATCTGAGAGTGAGGTTGG + Intergenic
1060642308 9:125249321-125249343 CTGTAATCCCAGCTACAGGTTGG - Intergenic
1061440570 9:130600470-130600492 ATGTAATCTAAATTAGAGGTTGG + Intronic
1185725384 X:2416647-2416669 CTGTCATCTAAGATGAAAGTGGG - Intronic
1189557433 X:42160130-42160152 CTGTGATCTGAGAGAGTGGTTGG + Intergenic
1190123619 X:47684101-47684123 CTGTAATACAAGAAAGAAGTTGG + Intergenic
1194525747 X:94975637-94975659 CTGTGTTCTAACAGAGAGGTTGG + Intergenic
1196253385 X:113487502-113487524 CTGGAATCCAAAATAGAGGTGGG - Intergenic
1197406715 X:126062773-126062795 CTGTGGTCTGAGACAGAGGTTGG - Intergenic
1198028155 X:132729201-132729223 CAGTAACCTAAGATTAAGGTGGG + Intronic
1200579737 Y:4935774-4935796 CTGTAATCCAAGAGTGTGGTTGG + Intergenic
1200715291 Y:6533918-6533940 GTCAAATCTAAGATATAGGTCGG - Intergenic
1200715373 Y:6535627-6535649 CTCGAATCTAAGATATACGTCGG - Intergenic