ID: 1052453314

View in Genome Browser
Species Human (GRCh38)
Location 9:28661352-28661374
Sequence GTCAACTGTAGGGCAGGCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 142}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052453314_1052453319 19 Left 1052453314 9:28661352-28661374 CCTTGGCCTGCCCTACAGTTGAC 0: 1
1: 0
2: 0
3: 19
4: 142
Right 1052453319 9:28661394-28661416 TCAGGTACAATACTGAATCTAGG No data
1052453314_1052453318 1 Left 1052453314 9:28661352-28661374 CCTTGGCCTGCCCTACAGTTGAC 0: 1
1: 0
2: 0
3: 19
4: 142
Right 1052453318 9:28661376-28661398 TCATGTGAGTAAGTGAGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052453314 Original CRISPR GTCAACTGTAGGGCAGGCCA AGG (reversed) Intronic
901923767 1:12553319-12553341 GCCAACTGTAGGTCAGGCAGTGG - Intergenic
903431031 1:23300164-23300186 GTCACCTTTAGGGCTGGGCATGG + Intergenic
903780733 1:25818622-25818644 TTCCACTGTGGGTCAGGCCAAGG - Intronic
904586679 1:31584617-31584639 GGCACCTGAGGGGCAGGCCAGGG + Intronic
924357805 1:243201852-243201874 GTCAACTGAATCCCAGGCCAGGG + Intronic
1063022846 10:2146794-2146816 ATCACCTGGAGGGCAGGTCATGG - Intergenic
1063678586 10:8164126-8164148 TTCAACTGTAGGTCAGGCACAGG - Intergenic
1065265108 10:23966536-23966558 GCAAACTGCAGGGCAGGGCAGGG - Intronic
1066197572 10:33116044-33116066 GCCCACCGTAGGGCTGGCCACGG - Intergenic
1067159712 10:43815008-43815030 CTCAATTGGAGGGCAGGGCAGGG - Intergenic
1067369943 10:45673343-45673365 GAGAACTGTAGGCCAGGCAATGG + Intergenic
1070375711 10:75829288-75829310 TTCAACTGTTGGGCTGGCCTTGG - Intronic
1070767221 10:79063705-79063727 GTGAACTGTAGCTCAGTCCAAGG + Intergenic
1076997932 11:308072-308094 GTCAAATGCAGAGCTGGCCAGGG - Exonic
1079993857 11:27274681-27274703 GTCAATCCTAGGGCAGGCCCTGG - Intergenic
1080406700 11:31986494-31986516 GTCAACAGGAGGGCAGGGCTTGG + Intronic
1081462828 11:43287305-43287327 TTCAACTGTAGGGTGAGCCAGGG + Intergenic
1084440501 11:69170060-69170082 GTCAACAGCAGGGCAGGACGAGG + Intergenic
1089001142 11:115053488-115053510 GTGAAGGGTAGGGCTGGCCAGGG - Intergenic
1092495078 12:8985694-8985716 GAGAACTGTAGGGCAGGGTATGG + Intronic
1094567132 12:31609920-31609942 ATCAACTGTTGGTCAGGGCATGG + Intergenic
1098149053 12:67527848-67527870 GCAGATTGTAGGGCAGGCCAAGG + Intergenic
1100814457 12:98372860-98372882 GCCAACTGTAGGGCAGGCTTTGG + Intergenic
1102818385 12:115887335-115887357 CTCAACTGTAGAGAGGGCCAGGG + Intergenic
1107763413 13:43707311-43707333 ATCAACTTTGGGGCAGGTCACGG - Intronic
1107865951 13:44703515-44703537 GTCCACTGTGAGGCAGGCCCTGG - Intergenic
1110405884 13:75150071-75150093 GTCAATTGTAGGTCTGGCTAGGG - Intergenic
1116937399 14:50755915-50755937 CTCAACTGTTTGGGAGGCCAAGG - Intronic
1119488139 14:75005672-75005694 GTAAGCTGTAGGGAAGCCCAGGG - Intronic
1121113337 14:91327456-91327478 GGCCACTGTAAGGCAGGACATGG - Intronic
1121500371 14:94431203-94431225 ATGAACTGTAGGGCCGGGCATGG - Intergenic
1122159042 14:99769452-99769474 GCCCACTGTGGGGGAGGCCAAGG - Intronic
1122632023 14:103111561-103111583 GTCAGGAGCAGGGCAGGCCAGGG + Intergenic
1123219538 14:106843179-106843201 GTCATTTGTAGGTCAGGCCCAGG - Intergenic
1124006865 15:25801562-25801584 GTCAACTCTTGGGCAGCCAATGG + Intronic
1129403240 15:75298697-75298719 GCTAACTGTAGAGCAGGCGAGGG + Intergenic
1129476720 15:75790823-75790845 GCTAACTGTAGAGCAGGCAAGGG + Intergenic
1129604491 15:77018249-77018271 GTGAGCTGCTGGGCAGGCCATGG + Intronic
1130258958 15:82339307-82339329 GTTAACTGTAGACCAGGCCAGGG - Intergenic
1130269718 15:82439817-82439839 GTTAACTGTAGACCAGGCCAGGG + Intergenic
1130462059 15:84167115-84167137 GTTAACTGTAGACCAGGCCAGGG + Intergenic
1130473678 15:84246037-84246059 GTTAACTGTAGACCAGGCCAGGG + Intergenic
1130481093 15:84360101-84360123 GTTAACTGTAGACCAGGCCAGGG + Intergenic
1130490618 15:84427658-84427680 GTTAACTGTAGACCAGGCCAGGG - Intergenic
1130502206 15:84506428-84506450 GTTAACTGTAGACCAGGCCAGGG - Intergenic
1130595962 15:85250634-85250656 GTTAACTGTAGACCAGGCCAGGG + Intergenic
1131570380 15:93529009-93529031 GTCATCTGTAGAGCAGGTCAAGG - Intergenic
1134233246 16:12445760-12445782 GTCTACTGTATGCCAGGCCCTGG + Intronic
1135120456 16:19761858-19761880 GTCCAGAGTAGGGCAGGCCCAGG + Intronic
1135722407 16:24828772-24828794 GTCAACTGTTAGCCAGGACAGGG - Intergenic
1135838563 16:25851699-25851721 GTGAACTGTGGGGCAGGCGGGGG + Intronic
1136596141 16:31251366-31251388 GCCAAATGTCTGGCAGGCCAAGG - Intergenic
1137301839 16:47156830-47156852 GTCATATGCAGGCCAGGCCAAGG + Intronic
1140582023 16:76241824-76241846 CCCAACTCCAGGGCAGGCCATGG - Intergenic
1141900620 16:86988142-86988164 GGCAACTGTGGTGCAGGCCCGGG - Intergenic
1147219730 17:38921209-38921231 GTGAACTGTAGAGAAGACCAGGG - Exonic
1147340473 17:39750689-39750711 GTCAGCTGTGTGGCTGGCCATGG + Intergenic
1148126281 17:45238812-45238834 GTGAAATGTTGGGCAGGCCAAGG + Intronic
1151649824 17:75459920-75459942 GTGAACTAGAGGGTAGGCCATGG + Intronic
1152729643 17:81963147-81963169 GCCAAGTGTGGGGCTGGCCAAGG + Intergenic
1161469517 19:4449264-4449286 GTGAACAGAAGGGCAGCCCAGGG + Intronic
925327285 2:3033233-3033255 GCCATCTGATGGGCAGGCCAGGG + Intergenic
925439380 2:3870994-3871016 GTTAACTGTAGTGCATACCATGG + Intergenic
927498247 2:23564690-23564712 ATCAACTGATGGGCAGGCCCGGG + Intronic
927705747 2:25295329-25295351 GTCAGCTGCAGGGCAGGGCGGGG - Intronic
927808803 2:26170789-26170811 CTCAACAGTTTGGCAGGCCAAGG - Intergenic
928197992 2:29228775-29228797 GTCCACACTTGGGCAGGCCAGGG + Intronic
929964013 2:46520178-46520200 GGCAGCTGCAGGGCAGGGCAGGG + Intronic
931680983 2:64750206-64750228 GTCCACTGTTGGGGAGGGCAGGG - Intronic
932421939 2:71606318-71606340 TTCAAATGCAGGGCAGACCAGGG - Intronic
932576107 2:72963280-72963302 GGCAAGTGAAGAGCAGGCCATGG + Intronic
934541895 2:95182270-95182292 TAGAACTGTAGGGGAGGCCATGG + Exonic
936480010 2:112877387-112877409 GGCATCAGCAGGGCAGGCCACGG - Intergenic
936617811 2:114066375-114066397 GTCAGCTGTGAGGCAGGTCAGGG - Intergenic
937764311 2:125641719-125641741 GCCAACTGCAGGGGAGGGCAAGG - Intergenic
938085606 2:128398622-128398644 ATCAACTGTAGGGCTGGGCACGG - Intergenic
938164803 2:129017320-129017342 ACCCTCTGTAGGGCAGGCCAAGG - Intergenic
938502251 2:131836194-131836216 GGCAGCTGTGGGGCAGGCTAGGG + Intergenic
938746741 2:134286261-134286283 GACAACTGTACAGCAGGCCCAGG - Intronic
944496657 2:200313984-200314006 CTGAACTGTAGGGGAGGCTAAGG - Intronic
945324282 2:208464620-208464642 TTCAACAGAAGGGCAGGCCTGGG - Intronic
947885202 2:233563895-233563917 GTGAAGTGTAGGGCGGGTCATGG - Intronic
1173382637 20:42559999-42560021 GTCAAAATGAGGGCAGGCCATGG - Intronic
1173850442 20:46214518-46214540 GTGTTTTGTAGGGCAGGCCAAGG - Intronic
1179399306 21:41069500-41069522 GTAAATTGTAGGGCTGGGCATGG + Intergenic
1182199796 22:28556761-28556783 ATCATCTGAAGGGCTGGCCAGGG + Intronic
1182848723 22:33453014-33453036 GAAAGCTGGAGGGCAGGCCAGGG - Intronic
1183326763 22:37198729-37198751 GGGAACTTTGGGGCAGGCCAGGG + Intronic
1184656565 22:45944736-45944758 GTCTGCTGTATGCCAGGCCAGGG - Intronic
950759020 3:15203989-15204011 GACATTTGTAGGACAGGCCAAGG + Intergenic
951801443 3:26601011-26601033 GTCAACGGTAGTCAAGGCCATGG + Intergenic
952529069 3:34244468-34244490 AGCAACTGTGGGGCTGGCCAAGG + Intergenic
952712577 3:36446161-36446183 GTTAGCTGGAGGGCATGCCACGG - Intronic
953393219 3:42545772-42545794 GTCAACTGCAGGGCTGGGCAAGG + Intergenic
953559049 3:43970951-43970973 GTGAACTGTAGGGTAGACCAGGG + Intergenic
953564286 3:44017680-44017702 GTCAACTGGAGGGCATCCCTCGG - Intergenic
953601989 3:44375613-44375635 TTAAACTGTAGCACAGGCCAAGG + Intronic
954857643 3:53660394-53660416 GTCAACTGTGAAGGAGGCCATGG - Intronic
956055027 3:65289681-65289703 GTCAGCTCTAGGACAGACCAAGG + Intergenic
958032397 3:88127517-88127539 GTCAAATATAGGGAAGGCAAGGG + Intronic
961806216 3:129491163-129491185 GTCACCTGCAAGGCAGGCCGGGG + Intronic
962611373 3:137079416-137079438 TTCTAGTGTGGGGCAGGCCAAGG + Intergenic
963130198 3:141850790-141850812 ATCAACTCTTTGGCAGGCCAAGG - Intergenic
963554496 3:146771164-146771186 GTGAACTATCTGGCAGGCCATGG - Intergenic
963586636 3:147199557-147199579 GTCATCTGAAGGGCAGCCCATGG + Intergenic
965568160 3:170143343-170143365 GTTAACTGTAGAGAATGCCAGGG + Intronic
966226505 3:177603762-177603784 GTCAAATGTAGGGCTGGCTAAGG + Intergenic
969061728 4:4440959-4440981 GTCATCTGAAGGGCTGACCAGGG + Intronic
969458622 4:7315457-7315479 GTCTGCTCTGGGGCAGGCCAGGG + Intronic
972961132 4:44453304-44453326 GTGAACAGCAGGCCAGGCCAGGG + Intergenic
979211832 4:118113998-118114020 GTCAACTGAACTGCAGGCCAAGG + Intronic
979244003 4:118477628-118477650 GTCAACTGAATCCCAGGCCAGGG - Intergenic
982133106 4:152247844-152247866 GGCAGCTGGAGGTCAGGCCAAGG - Intergenic
986432980 5:7699836-7699858 GTCAACAGTTTGGGAGGCCAAGG - Intronic
986645631 5:9913660-9913682 GTCTACTGTGTGCCAGGCCAGGG + Intergenic
991425965 5:66492049-66492071 GCCGACTGTAGGGGAGACCATGG + Intergenic
1001257730 5:170197421-170197443 GTCATCTGTAGGGCAGCTGAGGG - Intergenic
1011519294 6:88186909-88186931 GTCAACTTTAGAGGATGCCAGGG + Intergenic
1016170391 6:141007383-141007405 GTCAGCTGCAGGGCATGGCATGG + Intergenic
1018903040 6:168060646-168060668 GGCCACTGGAGGGCAGGCCAGGG + Intronic
1019488246 7:1299266-1299288 CTCAGCTGGAGGCCAGGCCACGG - Intergenic
1019738710 7:2662547-2662569 GTCATCTCTAGGGCAGGCTGGGG + Exonic
1021078450 7:16334155-16334177 GCCAACTGAAGTGCAGTCCATGG + Intronic
1022832814 7:34085482-34085504 GTCATCTGTAGGTCAAACCAGGG + Intronic
1024511906 7:50211473-50211495 GCCAACTGGAGGGCAGGAAAGGG - Intergenic
1026905166 7:74058766-74058788 CTCAACTGTATGTCAGGCCCTGG + Intronic
1029893094 7:103952205-103952227 GTGAACTGTAAGGCAGGAAATGG + Intronic
1032253569 7:130278911-130278933 GTCCATTGTAGGCCTGGCCAGGG - Intronic
1032475541 7:132209162-132209184 GTCAACCAAAGGCCAGGCCATGG + Intronic
1033881491 7:145889182-145889204 CTGAACTTTAGGGCAGGCCAAGG - Intergenic
1034849421 7:154480021-154480043 GTCACCTGTGGGGCGGGGCAGGG - Intronic
1035814723 8:2527089-2527111 CTCCACTGTAGGGCAGGGGAAGG + Intergenic
1036700670 8:11011834-11011856 GTCCACTGCAGGGCAGCACATGG + Intronic
1041246099 8:55889734-55889756 GTCAAAAGTAAGGCAGGGCAGGG + Intronic
1044429143 8:92088334-92088356 GTGAACTGTAAGACAGGTCAGGG - Intronic
1046082877 8:109393884-109393906 ATCAACTGTAGGGCCGGGCGCGG + Intronic
1046687522 8:117244022-117244044 GTCTCCTGTAGGGCAGGCATTGG - Intergenic
1050626032 9:7504447-7504469 GTGAACTCCAGGGAAGGCCATGG + Intergenic
1050704527 9:8382056-8382078 GGCAACTGCTGGGCAGACCAAGG - Intronic
1052453314 9:28661352-28661374 GTCAACTGTAGGGCAGGCCAAGG - Intronic
1056385368 9:86092416-86092438 GGCAACTGTAGGTCAGCCCCAGG - Intronic
1056965642 9:91161179-91161201 GGCAGCTCAAGGGCAGGCCACGG + Intergenic
1057206750 9:93178062-93178084 GTCATGTGAAGGGCAAGCCAGGG - Intergenic
1060847842 9:126851280-126851302 GTCAACTGTATGGAAAGGCAGGG + Intergenic
1061388758 9:130305749-130305771 GCCAATAGTAGGGCAGGCCTTGG + Intronic
1061709895 9:132480297-132480319 GTCAACAGCAGGGCAGGAAAGGG + Intronic
1185868618 X:3644654-3644676 TTCAACTGCTGGGCAGGGCAGGG - Intronic
1186515672 X:10164704-10164726 GTGAACTACAGGGCAGGACATGG + Intronic
1186626205 X:11296397-11296419 GTAAACTGTTGGGCAGGATAGGG + Intronic
1187590666 X:20713858-20713880 GTTAACTGCAATGCAGGCCAGGG + Intergenic
1190520696 X:51276821-51276843 GGCAACTGTATGGCATACCAAGG - Intergenic
1198144494 X:133841348-133841370 GACAACTTTAGGGCTGGGCACGG - Intronic
1198585570 X:138116915-138116937 GTTTACTGTAGAACAGGCCAGGG + Intergenic
1199694101 X:150331368-150331390 GTCAACTGTGGGGCATGCATAGG + Intergenic
1200254099 X:154570178-154570200 GGCAACTGAAGGGCATGGCAGGG - Intergenic
1200263670 X:154634230-154634252 GGCAACTGAAGGGCATGGCAGGG + Intergenic
1202173949 Y:22080335-22080357 GACAACTGGAGACCAGGCCATGG - Intronic
1202181844 Y:22146486-22146508 CTCAACTGTACACCAGGCCATGG + Intergenic
1202209516 Y:22439916-22439938 CTCAACTGTACACCAGGCCATGG - Intergenic
1202217411 Y:22506047-22506069 GACAACTGGAGACCAGGCCATGG + Intronic
1202325775 Y:23690012-23690034 GACAACTGGAGACCAGGCCATGG - Intergenic
1202544996 Y:25980042-25980064 GACAACTGGAGACCAGGCCATGG + Intergenic