ID: 1052454521

View in Genome Browser
Species Human (GRCh38)
Location 9:28678254-28678276
Sequence CTTTCAGCACAGATGGAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052454521_1052454524 7 Left 1052454521 9:28678254-28678276 CCAGGCTCCATCTGTGCTGAAAG No data
Right 1052454524 9:28678284-28678306 CTATTTCAAAGCCCTTACATGGG No data
1052454521_1052454525 14 Left 1052454521 9:28678254-28678276 CCAGGCTCCATCTGTGCTGAAAG No data
Right 1052454525 9:28678291-28678313 AAAGCCCTTACATGGGCTGTTGG No data
1052454521_1052454523 6 Left 1052454521 9:28678254-28678276 CCAGGCTCCATCTGTGCTGAAAG No data
Right 1052454523 9:28678283-28678305 TCTATTTCAAAGCCCTTACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052454521 Original CRISPR CTTTCAGCACAGATGGAGCC TGG (reversed) Intergenic
No off target data available for this crispr