ID: 1052463347

View in Genome Browser
Species Human (GRCh38)
Location 9:28795819-28795841
Sequence ACATATCAGAAGGAACTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052463344_1052463347 -5 Left 1052463344 9:28795801-28795823 CCTTACTATCTTTTACTAACATA No data
Right 1052463347 9:28795819-28795841 ACATATCAGAAGGAACTGGAAGG No data
1052463343_1052463347 23 Left 1052463343 9:28795773-28795795 CCACAATAATTATTCTTTTCAAA No data
Right 1052463347 9:28795819-28795841 ACATATCAGAAGGAACTGGAAGG No data
1052463342_1052463347 24 Left 1052463342 9:28795772-28795794 CCCACAATAATTATTCTTTTCAA No data
Right 1052463347 9:28795819-28795841 ACATATCAGAAGGAACTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052463347 Original CRISPR ACATATCAGAAGGAACTGGA AGG Intergenic
No off target data available for this crispr