ID: 1052464174

View in Genome Browser
Species Human (GRCh38)
Location 9:28809030-28809052
Sequence TGACATAGATATAGGGGGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052464169_1052464174 28 Left 1052464169 9:28808979-28809001 CCAGATTTTTATGCACTTATGTA No data
Right 1052464174 9:28809030-28809052 TGACATAGATATAGGGGGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052464174 Original CRISPR TGACATAGATATAGGGGGCA TGG Intergenic
No off target data available for this crispr