ID: 1052470296

View in Genome Browser
Species Human (GRCh38)
Location 9:28885323-28885345
Sequence CTGGACTCCCTGGAAGCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052470294_1052470296 -5 Left 1052470294 9:28885305-28885327 CCAGCAAATGGGACTAGGCTGGA No data
Right 1052470296 9:28885323-28885345 CTGGACTCCCTGGAAGCAGCAGG No data
1052470291_1052470296 0 Left 1052470291 9:28885300-28885322 CCTGGCCAGCAAATGGGACTAGG No data
Right 1052470296 9:28885323-28885345 CTGGACTCCCTGGAAGCAGCAGG No data
1052470288_1052470296 17 Left 1052470288 9:28885283-28885305 CCAGAAGCTGAGAGAGGCCTGGC No data
Right 1052470296 9:28885323-28885345 CTGGACTCCCTGGAAGCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052470296 Original CRISPR CTGGACTCCCTGGAAGCAGC AGG Intergenic
No off target data available for this crispr