ID: 1052473492

View in Genome Browser
Species Human (GRCh38)
Location 9:28929454-28929476
Sequence AGCTGCCTTCTCTGAGGATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052473492_1052473499 27 Left 1052473492 9:28929454-28929476 CCATATCCTCAGAGAAGGCAGCT No data
Right 1052473499 9:28929504-28929526 AGAAAATGGACAAGGAACTGAGG No data
1052473492_1052473496 19 Left 1052473492 9:28929454-28929476 CCATATCCTCAGAGAAGGCAGCT No data
Right 1052473496 9:28929496-28929518 AGTTACCCAGAAAATGGACAAGG No data
1052473492_1052473495 13 Left 1052473492 9:28929454-28929476 CCATATCCTCAGAGAAGGCAGCT No data
Right 1052473495 9:28929490-28929512 AATGACAGTTACCCAGAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052473492 Original CRISPR AGCTGCCTTCTCTGAGGATA TGG (reversed) Intergenic
No off target data available for this crispr