ID: 1052476893

View in Genome Browser
Species Human (GRCh38)
Location 9:28971576-28971598
Sequence GAGTGGGAGACTGCATCTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052476886_1052476893 19 Left 1052476886 9:28971534-28971556 CCATAGGGTGTGGCTCCTCTGCC No data
Right 1052476893 9:28971576-28971598 GAGTGGGAGACTGCATCTTGTGG No data
1052476890_1052476893 -2 Left 1052476890 9:28971555-28971577 CCTTTTGAAAGGCAGGAGAAAGA No data
Right 1052476893 9:28971576-28971598 GAGTGGGAGACTGCATCTTGTGG No data
1052476889_1052476893 4 Left 1052476889 9:28971549-28971571 CCTCTGCCTTTTGAAAGGCAGGA No data
Right 1052476893 9:28971576-28971598 GAGTGGGAGACTGCATCTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052476893 Original CRISPR GAGTGGGAGACTGCATCTTG TGG Intergenic
No off target data available for this crispr