ID: 1052479560

View in Genome Browser
Species Human (GRCh38)
Location 9:29006282-29006304
Sequence CCTTTAGGACAAAAAGAACA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052479557_1052479560 -4 Left 1052479557 9:29006263-29006285 CCTGTTGCTGCAGTTCTTGCCTT No data
Right 1052479560 9:29006282-29006304 CCTTTAGGACAAAAAGAACACGG No data
1052479556_1052479560 -3 Left 1052479556 9:29006262-29006284 CCCTGTTGCTGCAGTTCTTGCCT No data
Right 1052479560 9:29006282-29006304 CCTTTAGGACAAAAAGAACACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052479560 Original CRISPR CCTTTAGGACAAAAAGAACA CGG Intergenic
No off target data available for this crispr