ID: 1052487817

View in Genome Browser
Species Human (GRCh38)
Location 9:29125356-29125378
Sequence CCATGGCACATATATACCTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052487813_1052487817 10 Left 1052487813 9:29125323-29125345 CCTAGATGACGTGTTGATAGGTG No data
Right 1052487817 9:29125356-29125378 CCATGGCACATATATACCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052487817 Original CRISPR CCATGGCACATATATACCTA TGG Intergenic
No off target data available for this crispr