ID: 1052490599

View in Genome Browser
Species Human (GRCh38)
Location 9:29161698-29161720
Sequence ACTTTAAAACCACTCCCTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052490598_1052490599 2 Left 1052490598 9:29161673-29161695 CCTATACTGCTGATCTAGGAATA No data
Right 1052490599 9:29161698-29161720 ACTTTAAAACCACTCCCTTATGG No data
1052490596_1052490599 12 Left 1052490596 9:29161663-29161685 CCAGATGATGCCTATACTGCTGA No data
Right 1052490599 9:29161698-29161720 ACTTTAAAACCACTCCCTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052490599 Original CRISPR ACTTTAAAACCACTCCCTTA TGG Intergenic