ID: 1052497100

View in Genome Browser
Species Human (GRCh38)
Location 9:29240842-29240864
Sequence TTGATTGTCCCCAGATTTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052497098_1052497100 18 Left 1052497098 9:29240801-29240823 CCTTGATTATTTTTAAGTTGGTA No data
Right 1052497100 9:29240842-29240864 TTGATTGTCCCCAGATTTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052497100 Original CRISPR TTGATTGTCCCCAGATTTGT GGG Intergenic
No off target data available for this crispr