ID: 1052508279

View in Genome Browser
Species Human (GRCh38)
Location 9:29382238-29382260
Sequence GACTGTGAGCTGTACATGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052508275_1052508279 10 Left 1052508275 9:29382205-29382227 CCCAACTTCTGAGACCATCTTTG No data
Right 1052508279 9:29382238-29382260 GACTGTGAGCTGTACATGGACGG No data
1052508276_1052508279 9 Left 1052508276 9:29382206-29382228 CCAACTTCTGAGACCATCTTTGA No data
Right 1052508279 9:29382238-29382260 GACTGTGAGCTGTACATGGACGG No data
1052508277_1052508279 -4 Left 1052508277 9:29382219-29382241 CCATCTTTGAACATCAGTAGACT No data
Right 1052508279 9:29382238-29382260 GACTGTGAGCTGTACATGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052508279 Original CRISPR GACTGTGAGCTGTACATGGA CGG Intergenic
No off target data available for this crispr