ID: 1052509841

View in Genome Browser
Species Human (GRCh38)
Location 9:29401787-29401809
Sequence TACACAATGAACAGTAAGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052509841_1052509843 14 Left 1052509841 9:29401787-29401809 CCAAACTTACTGTTCATTGTGTA No data
Right 1052509843 9:29401824-29401846 AAGTATTTCCTAAACTAGCAGGG No data
1052509841_1052509842 13 Left 1052509841 9:29401787-29401809 CCAAACTTACTGTTCATTGTGTA No data
Right 1052509842 9:29401823-29401845 AAAGTATTTCCTAAACTAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052509841 Original CRISPR TACACAATGAACAGTAAGTT TGG (reversed) Intergenic
No off target data available for this crispr