ID: 1052509843

View in Genome Browser
Species Human (GRCh38)
Location 9:29401824-29401846
Sequence AAGTATTTCCTAAACTAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052509841_1052509843 14 Left 1052509841 9:29401787-29401809 CCAAACTTACTGTTCATTGTGTA No data
Right 1052509843 9:29401824-29401846 AAGTATTTCCTAAACTAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052509843 Original CRISPR AAGTATTTCCTAAACTAGCA GGG Intergenic
No off target data available for this crispr