ID: 1052514902

View in Genome Browser
Species Human (GRCh38)
Location 9:29467717-29467739
Sequence CTGGGTAAAATCTCTGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1052514895_1052514902 -1 Left 1052514895 9:29467695-29467717 CCTGTCCCTGATCCTTTGAGCAC No data
Right 1052514902 9:29467717-29467739 CTGGGTAAAATCTCTGAGGAAGG No data
1052514893_1052514902 28 Left 1052514893 9:29467666-29467688 CCACAAGGAGGTTTTCTCAGATC No data
Right 1052514902 9:29467717-29467739 CTGGGTAAAATCTCTGAGGAAGG No data
1052514899_1052514902 -7 Left 1052514899 9:29467701-29467723 CCTGATCCTTTGAGCACTGGGTA No data
Right 1052514902 9:29467717-29467739 CTGGGTAAAATCTCTGAGGAAGG No data
1052514898_1052514902 -6 Left 1052514898 9:29467700-29467722 CCCTGATCCTTTGAGCACTGGGT No data
Right 1052514902 9:29467717-29467739 CTGGGTAAAATCTCTGAGGAAGG No data
1052514894_1052514902 0 Left 1052514894 9:29467694-29467716 CCCTGTCCCTGATCCTTTGAGCA No data
Right 1052514902 9:29467717-29467739 CTGGGTAAAATCTCTGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1052514902 Original CRISPR CTGGGTAAAATCTCTGAGGA AGG Intergenic
No off target data available for this crispr